Incidental Mutation 'R4866:Ptprt'
ID 374892
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 042476-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R4866 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 161402159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1023 (D1023G)
Ref Sequence ENSEMBL: ENSMUSP00000105068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: D1024G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: D1024G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: D1023G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: D1023G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: D1014G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: D1014G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: D1004G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: D1004G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.6981 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,593,274 (GRCm39) R224C probably damaging Het
Abcc5 A T 16: 20,241,182 (GRCm39) M1K probably null Het
Ablim2 C T 5: 35,959,766 (GRCm39) R73C possibly damaging Het
Adam5 A C 8: 25,232,172 (GRCm39) probably null Het
Adam5 G A 8: 25,271,619 (GRCm39) T596I probably damaging Het
Apoa2 T C 1: 171,053,369 (GRCm39) probably null Het
Atad1 A T 19: 32,679,964 (GRCm39) H79Q probably benign Het
Atp8a2 T C 14: 59,928,916 (GRCm39) D1046G probably damaging Het
Bcam A G 7: 19,499,397 (GRCm39) Y209H probably benign Het
Brpf1 G A 6: 113,299,431 (GRCm39) V1120I probably damaging Het
Catsperb G A 12: 101,474,208 (GRCm39) C302Y probably damaging Het
Cbl A G 9: 44,064,166 (GRCm39) V790A probably benign Het
Ccdc60 T C 5: 116,310,549 (GRCm39) D171G probably damaging Het
Cd300c2 A T 11: 114,891,807 (GRCm39) C22* probably null Het
Cdan1 C A 2: 120,561,928 (GRCm39) probably benign Het
Cdk5rap1 C T 2: 154,212,876 (GRCm39) probably null Het
Cfap410 T A 10: 77,817,413 (GRCm39) probably null Het
Cfap65 T C 1: 74,964,716 (GRCm39) D479G probably damaging Het
Cmbl A G 15: 31,585,490 (GRCm39) K113E probably benign Het
Cog6 G A 3: 52,918,019 (GRCm39) T173I probably benign Het
Cts6 T A 13: 61,350,090 (GRCm39) probably null Het
Cyp11a1 G A 9: 57,933,380 (GRCm39) V413M probably damaging Het
Cyp2c39 G A 19: 39,502,020 (GRCm39) M136I probably benign Het
Dclre1b A T 3: 103,715,412 (GRCm39) Y29N probably damaging Het
Depdc1a T A 3: 159,221,764 (GRCm39) I236K probably damaging Het
Dhx36 A T 3: 62,380,198 (GRCm39) Y833N probably damaging Het
Dop1b G T 16: 93,560,318 (GRCm39) probably null Het
Elovl3 A G 19: 46,120,603 (GRCm39) E32G possibly damaging Het
Entrep1 A G 19: 23,952,790 (GRCm39) S507P possibly damaging Het
Epcam T C 17: 87,951,049 (GRCm39) V212A possibly damaging Het
Fcrl2 A T 3: 87,170,773 (GRCm39) C4S possibly damaging Het
Galnt16 T C 12: 80,630,851 (GRCm39) Y310H probably damaging Het
Gm12789 G A 4: 101,846,182 (GRCm39) probably benign Het
Gspt1 C T 16: 11,040,529 (GRCm39) R593H possibly damaging Het
Hmcn2 A T 2: 31,279,403 (GRCm39) T1802S possibly damaging Het
Igha A G 12: 113,223,129 (GRCm39) V166A probably benign Het
Itfg2 A G 6: 128,393,279 (GRCm39) probably benign Het
Jund T C 8: 71,152,254 (GRCm39) V183A probably damaging Het
Katnb1 T C 8: 95,824,132 (GRCm39) S471P possibly damaging Het
Kazn A G 4: 141,832,216 (GRCm39) F661S unknown Het
Kif19a G A 11: 114,658,053 (GRCm39) M37I probably benign Het
Lgr5 C T 10: 115,288,590 (GRCm39) V661I probably benign Het
Lvrn G T 18: 47,026,768 (GRCm39) A789S probably damaging Het
Mapk10 T C 5: 103,111,391 (GRCm39) D351G probably damaging Het
Mga T A 2: 119,794,535 (GRCm39) C2622S possibly damaging Het
Mios T G 6: 8,214,857 (GRCm39) F18V probably damaging Het
Mllt6 A G 11: 97,565,285 (GRCm39) D575G probably damaging Het
Mmp10 G A 9: 7,508,190 (GRCm39) V439M probably damaging Het
Myh4 A G 11: 67,139,453 (GRCm39) D590G probably benign Het
Ndufs2 C T 1: 171,074,618 (GRCm39) G14R probably benign Het
Or10ad1b T A 15: 98,125,371 (GRCm39) I52F probably damaging Het
Or51a7 A T 7: 102,614,927 (GRCm39) M207L probably benign Het
Or56a4 T C 7: 104,806,514 (GRCm39) Y125C possibly damaging Het
Or8g26 A G 9: 39,096,367 (GRCm39) K298E probably damaging Het
Plau G T 14: 20,887,872 (GRCm39) V39L probably benign Het
Ppp3cb A G 14: 20,573,911 (GRCm39) C275R probably damaging Het
Ppp4r4 T G 12: 103,566,706 (GRCm39) M51R possibly damaging Het
Prr5 A G 15: 84,626,105 (GRCm39) Y60C probably damaging Het
Raly T A 2: 154,703,816 (GRCm39) V129E probably damaging Het
Rsph10b A G 5: 143,885,347 (GRCm39) E249G probably benign Het
Sart1 A C 19: 5,432,248 (GRCm39) L577W probably damaging Het
Senp1 T C 15: 97,964,729 (GRCm39) E189G possibly damaging Het
Slc22a2 G T 17: 12,803,316 (GRCm39) C50F probably damaging Het
Spem1 A T 11: 69,711,755 (GRCm39) V303E probably damaging Het
Tgfb3 A G 12: 86,124,588 (GRCm39) V40A possibly damaging Het
Ttl T C 2: 128,923,147 (GRCm39) S163P probably damaging Het
Ttll9 C A 2: 152,844,920 (GRCm39) N429K probably benign Het
Uggt1 G A 1: 36,241,936 (GRCm39) R333* probably null Het
Zfhx2 A G 14: 55,302,993 (GRCm39) S1664P possibly damaging Het
Zfp51 T A 17: 21,682,012 (GRCm39) D70E possibly damaging Het
Zfp592 T A 7: 80,691,607 (GRCm39) V1262E probably damaging Het
Zfp595 C A 13: 67,465,760 (GRCm39) G168C probably damaging Het
Zswim9 A T 7: 12,995,095 (GRCm39) S354T probably damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGGGCACAAATCAGAC -3'
(R):5'- TATAATGGCCCCAATGACTCTG -3'

Sequencing Primer
(F):5'- GGGCACAAATCAGACGTTTGCTC -3'
(R):5'- AGTTAGGCCCTGCACAATTTG -3'
Posted On 2016-03-17