Mutagenetix > Incidental Mutation

Incidental Mutation 'R6298:Ptprt'

508873

Institutional Source

Beutler Lab

Gene Symbol

Ptprt

Ensembl Gene

ENSMUSG00000053141

Gene Name

protein tyrosine phosphatase, receptor type, T

Synonyms

RPTPrho

MMRRC Submission

044408-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R6298 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

161521990-162661147 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 161553859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1131 (H1131Q)

Ref Sequence

ENSEMBL: ENSMUSP00000105071 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000109441
AA Change: H1151Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: H1151Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1159	3.64e-129	SMART
PTPc	1188	1453	4.24e-98	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109442
AA Change: H1150Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: H1150Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	738	749	N/A	INTRINSIC
transmembrane domain	772	791	N/A	INTRINSIC
PTPc	901	1158	5.56e-134	SMART
PTPc	1187	1452	4.24e-98	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109443
AA Change: H1141Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: H1141Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
low complexity region	778	792	N/A	INTRINSIC
PTPc	892	1149	5.56e-134	SMART
PTPc	1178	1443	4.24e-98	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109445
AA Change: H1131Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: H1131Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
MAM	31	195	2.21e-71	SMART
IG	202	290	3.94e-2	SMART
FN3	292	375	3.35e-3	SMART
FN3	388	477	4.06e-2	SMART
FN3	489	579	1.2e-4	SMART
transmembrane domain	753	772	N/A	INTRINSIC
PTPc	882	1139	5.56e-134	SMART
PTPc	1168	1433	4.24e-98	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	T	A	13: 98,984,466	R17S	probably benign	Het
Abtb2	A	T	2: 103,709,488	M733L	probably benign	Het
Acss3	G	A	10: 107,084,856	P131L	probably damaging	Het
Adgrv1	T	A	13: 81,391,767	I5678F	probably benign	Het
Aff1	C	T	5: 103,754,720	L6F	possibly damaging	Het
AI314180	T	G	4: 58,877,157	T93P	probably damaging	Het
Ank3	G	T	10: 69,850,176	R273L	probably damaging	Het
Anks1b	G	A	10: 90,680,837	G898D	probably damaging	Het
Anxa11	C	T	14: 25,872,734	P131S	unknown	Het
Ap4e1	T	A	2: 127,047,115	M500K	probably benign	Het
Bag3	T	C	7: 128,540,198	S138P	probably damaging	Het
Capn9	T	C	8: 124,617,454	V670A	probably benign	Het
Ccne2	T	A	4: 11,199,306	W236R	probably damaging	Het
Cdh23	A	T	10: 60,426,672	Y702*	probably null	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cit	A	T	5: 115,948,065	E896V	probably damaging	Het
Cntln	T	A	4: 85,096,761	N1096K	probably damaging	Het
Cntnap5c	T	C	17: 58,104,752	C544R	probably damaging	Het
Csf1	A	T	3: 107,748,359	L452Q	possibly damaging	Het
Cts8	T	A	13: 61,249,223	K294N	possibly damaging	Het
D430042O09Rik	T	C	7: 125,870,697	V1446A	probably benign	Het
Dcakd	T	G	11: 102,999,792	E56D	possibly damaging	Het
Dnah17	T	C	11: 118,108,161	I929V	probably benign	Het
Dnah2	G	T	11: 69,491,641	H1214Q	probably benign	Het
Dock9	T	C	14: 121,634,594	D536G	probably damaging	Het
Drc3	A	G	11: 60,393,770	N467S	possibly damaging	Het
Dysf	A	G	6: 84,107,136		probably null	Het
Evpl	A	T	11: 116,230,922	L378Q	probably damaging	Het
Fer1l4	A	T	2: 156,024,740	H1520Q	probably damaging	Het
Fhod1	A	T	8: 105,337,148		probably benign	Het
Gabra1	T	A	11: 42,182,378		probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14137	A	G	2: 119,175,091	T44A	possibly damaging	Het
Gm9833	T	C	3: 10,089,179	I336T	probably damaging	Het
Herc2	T	C	7: 56,191,265	M3444T	probably benign	Het
Igsf5	T	C	16: 96,396,448	S208P	possibly damaging	Het
Ino80b	A	G	6: 83,125,085	L12P	possibly damaging	Het
Insrr	A	G	3: 87,812,965	D970G	probably damaging	Het
Iqcf4	G	A	9: 106,568,675	A91V	probably benign	Het
Itga10	A	G	3: 96,656,762	T911A	probably benign	Het
Klhl30	A	T	1: 91,357,364	D314V	probably benign	Het
Lpcat1	T	C	13: 73,510,955	V330A	possibly damaging	Het
Nhlrc3	A	T	3: 53,452,523	D306E	possibly damaging	Het
Notum	T	A	11: 120,657,940	I187F	probably damaging	Het
Nphp3	T	C	9: 104,015,441	L288P	probably damaging	Het
Ntrk2	G	T	13: 58,871,756	E394*	probably null	Het
Olfr420	T	A	1: 174,152,182	V222D	probably benign	Het
Pbld2	A	G	10: 63,039,152	K63E	probably benign	Het
Phc2	T	C	4: 128,748,189	M768T	possibly damaging	Het
Pik3c2g	G	A	6: 139,626,563	C249Y	probably damaging	Het
Plod1	G	A	4: 147,916,315		probably benign	Het
Plscr2	A	T	9: 92,290,719	T9S	probably benign	Het
Pnrc1	T	A	4: 33,246,315	M215L	probably benign	Het
Prcp	G	T	7: 92,928,633	C370F	probably damaging	Het
Pter	A	G	2: 12,978,394	N70S	probably damaging	Het
Rasal2	T	C	1: 157,411,862	D8G	possibly damaging	Het
Rcn2	A	C	9: 56,052,925	K159Q	probably benign	Het
Rex2	T	A	4: 147,057,515	C153*	probably null	Het
Rps6ka2	T	C	17: 7,170,367	F8S	possibly damaging	Het
Samd9l	A	G	6: 3,375,383	L626S	probably damaging	Het
Sptb	A	G	12: 76,620,654		probably null	Het
Srgap3	A	T	6: 112,816,610	V135D	probably damaging	Het
Srsf7	T	C	17: 80,207,253		probably benign	Het
Tacc2	A	G	7: 130,626,525	T1647A	probably benign	Het
Thap12	G	T	7: 98,703,405	A6S	probably damaging	Het
Tmem33	T	A	5: 67,268,551	L146*	probably null	Het
Trip13	C	A	13: 73,936,259	E36*	probably null	Het
Vkorc1l1	T	A	5: 129,942,238	C23S	probably damaging	Het
Vmn1r20	G	A	6: 57,432,127	R146H	probably benign	Het
Vmn1r222	T	A	13: 23,232,795	I83F	probably benign	Het
Vmn2r107	A	T	17: 20,355,782	I125F	probably benign	Het
Vmn2r116	A	G	17: 23,386,762	D216G	probably damaging	Het
Vwa3a	C	T	7: 120,795,651	T898I	probably benign	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Wdhd1	T	C	14: 47,273,122	D148G	possibly damaging	Het
Xylt1	T	C	7: 117,656,737	I844T	probably damaging	Het
Zfp106	A	T	2: 120,522,704	V1535D	probably damaging	Het
Zfp385b	A	T	2: 77,413,979	L315Q	possibly damaging	Het
Zfp458	T	A	13: 67,256,806	H523L	probably damaging	Het
Zfp712	T	C	13: 67,041,329	H378R	probably damaging	Het
Zic1	T	C	9: 91,364,503	Y172C	probably damaging	Het

Other mutations in Ptprt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ptprt	APN	2	161810624	missense	probably benign	0.00
IGL00565:Ptprt	APN	2	161560191	missense	probably damaging	1.00
IGL00925:Ptprt	APN	2	161656163	missense	possibly damaging	0.52
IGL01344:Ptprt	APN	2	161551817	missense	probably damaging	1.00
IGL01432:Ptprt	APN	2	162268079	splice site	probably benign
IGL02008:Ptprt	APN	2	161927673	missense	probably benign	0.02
IGL02040:Ptprt	APN	2	162238072	missense	probably damaging	1.00
IGL02172:Ptprt	APN	2	161555502	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162238060	missense	probably damaging	1.00
IGL02231:Ptprt	APN	2	162278046	critical splice donor site	probably null
IGL02232:Ptprt	APN	2	161530517	missense	probably damaging	0.96
IGL02277:Ptprt	APN	2	161547381	missense	probably damaging	1.00
IGL02447:Ptprt	APN	2	162278107	missense	probably benign	0.01
IGL02601:Ptprt	APN	2	161766307	missense	probably benign	0.10
IGL02623:Ptprt	APN	2	161607452	splice site	probably benign
IGL03379:Ptprt	APN	2	161555459	nonsense	probably null
Poverina	UTSW	2	161901497	missense	possibly damaging	0.70
IGL03055:Ptprt	UTSW	2	161533613	missense	probably damaging	0.96
R0064:Ptprt	UTSW	2	161927791	splice site	probably benign
R0129:Ptprt	UTSW	2	162278070	missense	probably benign	0.35
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0131:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0132:Ptprt	UTSW	2	162278110	missense	probably benign	0.00
R0316:Ptprt	UTSW	2	161607319	missense	probably damaging	1.00
R0454:Ptprt	UTSW	2	161553822	missense	probably damaging	0.96
R0488:Ptprt	UTSW	2	161553825	missense	probably damaging	0.99
R0573:Ptprt	UTSW	2	161551748	missense	probably damaging	1.00
R0614:Ptprt	UTSW	2	161812120	missense	possibly damaging	0.59
R0834:Ptprt	UTSW	2	161812139	splice site	probably null
R1023:Ptprt	UTSW	2	161558943	missense	probably damaging	1.00
R1184:Ptprt	UTSW	2	161927772	missense	possibly damaging	0.82
R1253:Ptprt	UTSW	2	162278226	missense	probably damaging	1.00
R1476:Ptprt	UTSW	2	161927484	missense	probably damaging	1.00
R1515:Ptprt	UTSW	2	162238034	missense	probably damaging	1.00
R1595:Ptprt	UTSW	2	161810549	critical splice donor site	probably null
R1939:Ptprt	UTSW	2	161927640	missense	probably benign	0.45
R1987:Ptprt	UTSW	2	161558898	missense	probably damaging	1.00
R1987:Ptprt	UTSW	2	161766321	missense	possibly damaging	0.48
R2049:Ptprt	UTSW	2	161534545	missense	probably damaging	1.00
R2140:Ptprt	UTSW	2	161811988	missense	probably damaging	1.00
R2421:Ptprt	UTSW	2	162278040	splice site	probably benign
R3432:Ptprt	UTSW	2	161927529	missense	probably damaging	1.00
R3619:Ptprt	UTSW	2	161566157	missense	probably damaging	1.00
R3757:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3758:Ptprt	UTSW	2	161812030	missense	probably damaging	1.00
R3834:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3835:Ptprt	UTSW	2	161547387	missense	probably damaging	1.00
R3915:Ptprt	UTSW	2	161555555	splice site	probably benign
R4003:Ptprt	UTSW	2	161566117	splice site	probably benign
R4387:Ptprt	UTSW	2	161927650	missense	probably damaging	1.00
R4519:Ptprt	UTSW	2	161564689	missense	probably damaging	1.00
R4618:Ptprt	UTSW	2	161553845	missense	probably damaging	1.00
R4677:Ptprt	UTSW	2	161901446	critical splice donor site	probably null
R4866:Ptprt	UTSW	2	161560239	missense	probably damaging	1.00
R5088:Ptprt	UTSW	2	162238175	missense	probably benign	0.01
R5173:Ptprt	UTSW	2	161927756	missense	probably benign	0.01
R5215:Ptprt	UTSW	2	162278164	missense	probably damaging	1.00
R5383:Ptprt	UTSW	2	161698049	missense	probably damaging	1.00
R5398:Ptprt	UTSW	2	161927592	missense	probably damaging	1.00
R5518:Ptprt	UTSW	2	162278223	missense	probably damaging	0.99
R5711:Ptprt	UTSW	2	161810604	missense	probably damaging	0.98
R5735:Ptprt	UTSW	2	161534564	missense	probably damaging	0.98
R5834:Ptprt	UTSW	2	161560269	missense	probably damaging	1.00
R5872:Ptprt	UTSW	2	162135218	missense	probably damaging	1.00
R5926:Ptprt	UTSW	2	161564686	missense	probably benign	0.00
R6210:Ptprt	UTSW	2	162268029	missense	probably damaging	1.00
R6285:Ptprt	UTSW	2	161901497	missense	possibly damaging	0.70
R6406:Ptprt	UTSW	2	161553783	missense	probably damaging	0.98
R6499:Ptprt	UTSW	2	161534587	missense	probably benign	0.32
R6613:Ptprt	UTSW	2	161530447	missense	probably damaging	1.00
R6622:Ptprt	UTSW	2	161553840	missense	probably damaging	1.00
R7218:Ptprt	UTSW	2	161547364	missense	probably damaging	1.00
R7247:Ptprt	UTSW	2	161533523	missense	probably benign	0.15
R7576:Ptprt	UTSW	2	161607305	missense	possibly damaging	0.88
R7733:Ptprt	UTSW	2	161575787	missense	probably damaging	1.00
R7735:Ptprt	UTSW	2	161575741	missense	probably damaging	1.00
R7813:Ptprt	UTSW	2	161530493	missense	probably damaging	1.00
R8031:Ptprt	UTSW	2	162135457	missense	probably damaging	1.00
R8074:Ptprt	UTSW	2	161927661	missense	possibly damaging	0.77
R8151:Ptprt	UTSW	2	162278085	missense	probably damaging	1.00
R8236:Ptprt	UTSW	2	161687068	critical splice donor site	probably null
R8308:Ptprt	UTSW	2	161927646	missense	probably benign	0.00
R8348:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8362:Ptprt	UTSW	2	161551747	missense	probably damaging	1.00
R8365:Ptprt	UTSW	2	161901531	missense	probably benign	0.05
R8448:Ptprt	UTSW	2	161558886	missense	probably damaging	1.00
R8512:Ptprt	UTSW	2	161558863	missense	probably benign	0.00
R8715:Ptprt	UTSW	2	161530543	missense	probably damaging	1.00
R9004:Ptprt	UTSW	2	161766394	missense	probably benign	0.04
R9046:Ptprt	UTSW	2	161530441	missense	possibly damaging	0.58
R9222:Ptprt	UTSW	2	161560186	missense	probably damaging	1.00
R9297:Ptprt	UTSW	2	161575778	missense	probably benign
R9318:Ptprt	UTSW	2	161575778	missense	probably benign
R9476:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9510:Ptprt	UTSW	2	161555461	missense	probably damaging	1.00
R9571:Ptprt	UTSW	2	161553812	missense	probably benign	0.10
X0064:Ptprt	UTSW	2	161927483	missense	probably damaging	1.00
Z1088:Ptprt	UTSW	2	162238121	missense	possibly damaging	0.86
Z1177:Ptprt	UTSW	2	161732887	missense	probably damaging	1.00
Z1177:Ptprt	UTSW	2	162362948	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- TTGGGGATCAGTGTCCCTAATG -3'
(R):5'- CACTGGTGACTTAGACCTTTAGG -3'

Sequencing Primer
(F):5'- ATGTAAGTCACCCAGGCTGTG -3'
(R):5'- GCTCACAGGCATTTGTTC -3'

Posted On

2018-04-02