Incidental Mutation 'R5256:Golga4'
ID399676
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Namegolgi autoantigen, golgin subfamily a, 4
Synonymsgolgin-245, Olp-1
MMRRC Submission 042827-MU
Accession Numbers

Genbank: NM_018748; MGI: 1859646  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5256 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location118506267-118582519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118556501 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 869 (V869D)
Ref Sequence ENSEMBL: ENSMUSP00000148748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084820
AA Change: V897D

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: V897D

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211840
Predicted Effect possibly damaging
Transcript: ENSMUST00000212097
AA Change: V869D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212913
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730015C16Rik C A 4: 108,848,065 probably benign Het
Actr1b T C 1: 36,700,092 H372R probably benign Het
Ampd2 C A 3: 108,079,549 probably benign Het
Anapc4 A G 5: 52,863,594 S612G probably benign Het
Arhgef7 T C 8: 11,800,811 L141P probably damaging Het
Atl1 A G 12: 69,959,333 D471G probably damaging Het
Atrn A G 2: 130,946,019 D247G probably benign Het
Bag1 T A 4: 40,948,022 R61W probably damaging Het
Card10 C T 15: 78,778,251 R898H probably damaging Het
Cct6b G A 11: 82,764,220 A3V probably damaging Het
Cfap54 A T 10: 92,935,091 L2097* probably null Het
Cfap54 T C 10: 93,045,023 probably null Het
Chd5 T C 4: 152,372,097 F964L probably benign Het
Cog5 A G 12: 31,886,205 T584A probably benign Het
Cpa2 T A 6: 30,547,197 N157K probably damaging Het
Cpeb1 A T 7: 81,351,839 M440K probably damaging Het
Cracr2a G A 6: 127,604,029 C56Y probably damaging Het
Ddb2 A C 2: 91,236,728 L30R probably damaging Het
Dlk1 T A 12: 109,459,771 I190N probably damaging Het
Dnajc13 T A 9: 104,203,329 Y851F possibly damaging Het
Dopey1 T A 9: 86,515,328 L895Q probably damaging Het
Dyx1c1 T C 9: 72,972,080 probably null Het
F7 G A 8: 13,030,763 C122Y probably damaging Het
Frrs1 T C 3: 116,903,100 V573A possibly damaging Het
Gm17541 A T 12: 4,689,672 probably benign Het
Gm20388 T C 8: 122,270,436 probably benign Het
Gm5519 A T 19: 33,823,176 H90L probably damaging Het
Gm5526 T A 1: 45,857,409 noncoding transcript Het
Gm5709 A T 3: 59,602,550 noncoding transcript Het
Grm7 A T 6: 111,358,221 Q531L probably benign Het
Hnrnpu C A 1: 178,335,893 C265F unknown Het
Hoxd3 G A 2: 74,746,867 V364I possibly damaging Het
Hspb8 T C 5: 116,409,473 D150G probably damaging Het
Hydin C A 8: 110,587,223 N4244K possibly damaging Het
Ik A G 18: 36,748,873 D136G probably benign Het
Il11ra1 T C 4: 41,767,932 probably benign Het
Jph1 T C 1: 17,091,398 I347V probably benign Het
Klk1 T A 7: 44,221,561 probably benign Het
Lmcd1 T A 6: 112,288,126 probably benign Het
Lnx1 C T 5: 74,685,654 C45Y probably damaging Het
Macc1 T A 12: 119,446,529 M344K possibly damaging Het
Madcam1 A G 10: 79,664,945 E32G possibly damaging Het
Mat2a T C 6: 72,434,333 D383G probably benign Het
Mpst T A 15: 78,413,649 I289N probably damaging Het
Myh6 C T 14: 54,952,661 R1055Q probably damaging Het
Myh7 T C 14: 54,979,508 K1131E probably damaging Het
Ndrg3 A T 2: 156,931,205 probably benign Het
Nebl A G 2: 17,433,975 S209P probably benign Het
Nid2 A G 14: 19,768,208 probably null Het
Nup188 A T 2: 30,330,749 S945C probably damaging Het
Olfr1000 C T 2: 85,608,473 V146I probably benign Het
Olfr251 A G 9: 38,377,917 N12S probably benign Het
Olfr50 A G 2: 36,793,673 M146V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Patl2 A G 2: 122,128,887 L32P probably damaging Het
Pcdh20 T A 14: 88,468,377 M496L probably benign Het
Pdzd2 A G 15: 12,372,942 V2369A possibly damaging Het
Pfn2 A G 3: 57,847,391 V31A probably damaging Het
Plxna4 T C 6: 32,251,072 N533S probably benign Het
Plxnb1 T C 9: 109,114,593 F1916S probably damaging Het
Ppp4r3b T C 11: 29,188,293 F214L probably benign Het
Prox1 T C 1: 190,161,441 D269G probably benign Het
Rapgef4 T C 2: 72,034,034 F71S probably damaging Het
Rft1 A G 14: 30,661,286 I94M probably benign Het
S100z T C 13: 95,478,619 I13V probably damaging Het
Serhl T A 15: 83,102,634 V117E probably damaging Het
Shroom1 G A 11: 53,465,507 R336Q probably benign Het
Sik3 A T 9: 46,212,254 Q1067L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc28a1 G A 7: 81,122,121 V118M probably damaging Het
Slco1a6 T A 6: 142,132,701 I153F probably benign Het
Ss18l1 T C 2: 180,061,942 Y323H unknown Het
Susd4 G T 1: 182,892,259 A480S possibly damaging Het
Syne3 A T 12: 104,975,880 M1K probably null Het
Synpo2l A T 14: 20,661,014 S513T probably benign Het
Tat A T 8: 109,998,334 N388I probably benign Het
Tbc1d1 A G 5: 64,282,009 Y619C probably damaging Het
Tbk1 G A 10: 121,570,685 T216M probably damaging Het
Tns1 C T 1: 73,995,426 probably benign Het
Trbv5 T C 6: 41,062,384 V9A possibly damaging Het
Trpm5 A G 7: 143,082,303 Y575H probably damaging Het
Ttn A T 2: 76,739,701 Y25203* probably null Het
Tubb3 C A 8: 123,421,652 D441E probably benign Het
Usp33 T A 3: 152,391,696 C850* probably null Het
Vdac1 G A 11: 52,384,078 probably null Het
Vmn1r232 T C 17: 20,913,584 I251M probably damaging Het
Vmn2r11 T G 5: 109,054,792 I140L probably benign Het
Vmn2r6 A T 3: 64,556,842 N190K probably benign Het
Vps51 T A 19: 6,070,488 H465L probably benign Het
Zfp318 T G 17: 46,412,069 I1666S probably benign Het
Zfp446 C T 7: 12,979,304 R90* probably null Het
Zgrf1 T A 3: 127,602,445 F547I probably damaging Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118514271 critical splice donor site probably null
IGL00801:Golga4 APN 9 118538926 missense probably damaging 0.98
IGL01395:Golga4 APN 9 118535373 missense probably damaging 1.00
IGL01472:Golga4 APN 9 118532574 missense probably damaging 1.00
IGL01519:Golga4 APN 9 118527092 missense probably damaging 1.00
IGL01563:Golga4 APN 9 118527006 splice site probably benign
IGL02593:Golga4 APN 9 118555566 unclassified probably benign
IGL02803:Golga4 APN 9 118535460 missense probably benign
IGL02939:Golga4 APN 9 118535454 missense probably benign 0.01
IGL02939:Golga4 APN 9 118534632 missense probably damaging 1.00
IGL03123:Golga4 APN 9 118536885 missense probably damaging 1.00
IGL03334:Golga4 APN 9 118537233 splice site probably benign
F5770:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118553457 missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118553453 missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118560740 critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118568993 missense probably benign 0.00
R0362:Golga4 UTSW 9 118555785 missense probably benign 0.13
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0974:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R1128:Golga4 UTSW 9 118548784 missense probably benign 0.40
R1384:Golga4 UTSW 9 118565651 missense probably damaging 0.99
R1435:Golga4 UTSW 9 118535440 missense probably benign 0.00
R1513:Golga4 UTSW 9 118555732 missense probably benign 0.02
R1818:Golga4 UTSW 9 118572987 missense probably damaging 1.00
R2083:Golga4 UTSW 9 118532590 missense probably damaging 1.00
R2243:Golga4 UTSW 9 118556904 missense probably benign 0.06
R2355:Golga4 UTSW 9 118560742 missense probably benign 0.00
R2518:Golga4 UTSW 9 118556612 missense probably damaging 1.00
R2921:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118557380 missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118534647 missense probably benign 0.16
R3909:Golga4 UTSW 9 118558736 missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118538971 missense probably damaging 0.99
R4321:Golga4 UTSW 9 118556435 missense probably damaging 1.00
R4358:Golga4 UTSW 9 118551878 missense probably benign 0.16
R4483:Golga4 UTSW 9 118514186 missense probably damaging 1.00
R4515:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4518:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4519:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4545:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4546:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4580:Golga4 UTSW 9 118557259 missense probably benign 0.00
R4918:Golga4 UTSW 9 118558145 missense probably damaging 1.00
R5007:Golga4 UTSW 9 118558300 missense probably benign
R5045:Golga4 UTSW 9 118565656 missense probably benign
R5232:Golga4 UTSW 9 118506558 critical splice donor site probably null
R5502:Golga4 UTSW 9 118559057 nonsense probably null
R5567:Golga4 UTSW 9 118558183 missense probably damaging 1.00
R5576:Golga4 UTSW 9 118553534 missense probably benign 0.13
R5771:Golga4 UTSW 9 118558283 missense probably damaging 0.96
R5807:Golga4 UTSW 9 118527130 missense probably damaging 0.99
R5860:Golga4 UTSW 9 118558106 missense probably damaging 1.00
R6012:Golga4 UTSW 9 118559696 missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118558627 nonsense probably null
R6299:Golga4 UTSW 9 118557370 missense probably benign 0.03
R6467:Golga4 UTSW 9 118536792 missense probably damaging 1.00
R6552:Golga4 UTSW 9 118514231 missense probably damaging 1.00
R6688:Golga4 UTSW 9 118514210 missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118548779 missense probably damaging 1.00
R6987:Golga4 UTSW 9 118558532 missense probably benign
R7212:Golga4 UTSW 9 118536840 missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118559495 missense probably benign
R7431:Golga4 UTSW 9 118559731 missense probably damaging 1.00
R7641:Golga4 UTSW 9 118557575 missense probably benign 0.05
R7727:Golga4 UTSW 9 118548702 missense probably damaging 1.00
R7729:Golga4 UTSW 9 118556063 missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118532575 missense probably damaging 1.00
R7849:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118556366 missense probably damaging 1.00
R7932:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7974:Golga4 UTSW 9 118556366 missense probably damaging 1.00
RF022:Golga4 UTSW 9 118557989 missense probably damaging 1.00
V7583:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGGCCCAAATGCAGCAAAAG -3'
(R):5'- GCTCTAGGACAGTATTTTCAAGCTC -3'

Sequencing Primer
(F):5'- TGCAGCAAAAGGTGTTAGACC -3'
(R):5'- AAGTTTGGCTTCCTGATCCAACAAC -3'
Posted On2016-07-06