Incidental Mutation 'R5478:Slc9c1'
ID434183
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
MMRRC Submission 043039-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R5478 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45554246 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 296 (M296L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: M325L

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: M325L

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162151
AA Change: M296L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.1226 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T C 19: 43,839,465 probably benign Het
Adamts2 T C 11: 50,792,651 V920A possibly damaging Het
Alpk1 A G 3: 127,677,719 V1038A probably damaging Het
Amotl1 A G 9: 14,592,752 probably null Het
Apba2 T A 7: 64,695,186 Y41* probably null Het
BC048562 G A 9: 108,445,164 probably benign Het
Braf A G 6: 39,677,574 L86P possibly damaging Het
Capn3 A G 2: 120,464,185 probably null Het
Carmil1 T C 13: 24,112,045 D371G probably damaging Het
Cdhr4 G A 9: 107,995,591 V280I possibly damaging Het
Cdkl2 T A 5: 92,039,249 K53* probably null Het
Chl1 A T 6: 103,683,221 E353D probably damaging Het
Col4a2 T A 8: 11,398,697 N72K probably benign Het
Comtd1 A T 14: 21,848,913 probably benign Het
Ctsm A T 13: 61,537,729 S290T probably benign Het
Defa35 A T 8: 21,065,820 Y65F probably benign Het
Dock8 T A 19: 25,079,822 C198S probably benign Het
Epha3 A C 16: 63,583,533 M734R probably damaging Het
Fastkd2 T C 1: 63,739,186 I406T probably benign Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Gm16686 A T 4: 88,755,477 probably benign Het
Gm4922 T C 10: 18,784,137 E279G probably benign Het
Gm5709 A T 3: 59,635,674 noncoding transcript Het
Grin3a C A 4: 49,792,481 M417I probably benign Het
Hnf4a A T 2: 163,569,006 M408L probably benign Het
Hrasls5 A C 19: 7,614,671 probably benign Het
Idh1 A T 1: 65,161,838 M318K probably benign Het
Krt222 A G 11: 99,234,948 S286P probably damaging Het
Mmrn2 A T 14: 34,396,582 T142S probably benign Het
Myocd G T 11: 65,233,088 probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Olfr183 A T 16: 59,000,062 I126L possibly damaging Het
Olfr598 T C 7: 103,328,825 L113P probably damaging Het
Pcdhgc4 C T 18: 37,817,322 T597M probably damaging Het
Pdrg1 A G 2: 153,015,232 probably benign Het
Per2 T A 1: 91,432,868 I521F probably benign Het
Pkhd1 G A 1: 20,201,156 L3058F probably damaging Het
Pnliprp1 A T 19: 58,734,991 probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prpf18 A T 2: 4,638,894 N155K probably benign Het
Pum1 T A 4: 130,751,484 N472K possibly damaging Het
Reln A T 5: 22,004,203 S1126T probably benign Het
Rnase11 A G 14: 51,049,875 L74P probably damaging Het
Slc25a23 T A 17: 57,052,780 I324F probably damaging Het
Slc26a10 C A 10: 127,173,949 R576L probably benign Het
Slc4a1 T A 11: 102,350,314 E921D probably damaging Het
Sos1 T C 17: 80,433,847 D503G probably damaging Het
Srpk2 G A 5: 23,524,183 T486I possibly damaging Het
Sult6b1 A T 17: 78,894,672 probably null Het
Tbc1d16 T C 11: 119,155,091 E509G probably benign Het
Tktl2 T C 8: 66,513,398 V536A probably damaging Het
Ugt2b36 A T 5: 87,089,482 V188D probably damaging Het
Veph1 T C 3: 66,255,022 T72A probably damaging Het
Vmn2r73 A T 7: 85,869,788 I542N probably damaging Het
Vps13d G A 4: 145,167,550 P480S probably damaging Het
Zfp319 A G 8: 95,325,565 probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATCAGTTTCTCTGCTACATCATG -3'
(R):5'- AACTAACTGTTCAGGCTGAGG -3'

Sequencing Primer
(F):5'- GAATCCTATGTTTACCTGCATTAGTG -3'
(R):5'- CTGTTCAGGCTGAGGTATAAAATC -3'
Posted On2016-10-06