Mutagenetix > Incidental Mutations

Incidental Mutation 'R5615:Rsph4a'

438200

Institutional Source

Beutler Lab

Gene Symbol

Rsph4a

Ensembl Gene

ENSMUSG00000039552

Gene Name

radial spoke head 4 homolog A (Chlamydomonas)

Synonyms

Rshl3

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.209) question?

Stock #

R5615 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33905111-33916021 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 33909328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 412 (A412T)

Ref Sequence

ENSEMBL: ENSMUSP00000131647 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169670]

AlphaFold

Q8BYM7

Predicted Effect

probably benign
Transcript: ENSMUST00000118315
AA Change: A208T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000113543
Gene: ENSMUSG00000039552
AA Change: A208T

Domain	Start	End	E-Value	Type
Pfam:Radial_spoke	2	494	2.4e-193	PFAM
low complexity region	498	512	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169670
AA Change: A412T

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000131647
Gene: ENSMUSG00000039552
AA Change: A412T

Domain	Start	End	E-Value	Type
low complexity region	80	87	N/A	INTRINSIC
Pfam:Radial_spoke	209	695	2.7e-205	PFAM
low complexity region	702	716	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to be a component the radial spoke head, as determined by homology to similar proteins in the biflagellate alga Chlamydomonas reinhardtii and other ciliates. Radial spokes, which are regularly spaced along cilia, sperm, and flagella axonemes, consist of a thin 'stalk' and a bulbous 'head' that form a signal transduction scaffold between the central pair of microtubules and dynein. Mutations in this gene cause primary ciliary dyskinesia 1, a disease arising from dysmotility of motile cilia and sperm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,606,759	L407H	probably damaging	Het
Abca12	A	T	1: 71,307,059	L884H	probably damaging	Het
Ahr	A	G	12: 35,503,885	V745A	probably benign	Het
Ankrd17	A	T	5: 90,283,436	S830T	possibly damaging	Het
Aox1	A	G	1: 58,096,966	T1123A	probably benign	Het
Arhgef11	T	C	3: 87,722,485		probably null	Het
Bcas3	T	A	11: 85,470,761	C250S	probably damaging	Het
Bckdk	T	C	7: 127,907,317	I272T	probably damaging	Het
Cacna1e	T	C	1: 154,412,170	K1897E	probably damaging	Het
Cd180	A	T	13: 102,706,203	I586F	probably benign	Het
Cep290	A	G	10: 100,531,150	D1121G	probably damaging	Het
Clasrp	A	G	7: 19,586,447		probably benign	Het
Col27a1	G	T	4: 63,281,114	K912N	probably damaging	Het
Dock4	G	T	12: 40,649,480	R231L	probably benign	Het
Ell	G	A	8: 70,590,732	S505N	probably benign	Het
Ephb6	A	G	6: 41,619,291	T833A	probably benign	Het
Hemk1	T	A	9: 107,330,824		probably null	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hspa12a	T	C	19: 58,804,650	I368V	possibly damaging	Het
Igkv3-3	A	T	6: 70,687,230	T19S	probably benign	Het
Itpr1	G	A	6: 108,488,600	A2158T	possibly damaging	Het
Lancl2	T	C	6: 57,722,511	Y104H	probably damaging	Het
Leng8	G	T	7: 4,144,958	E634*	probably null	Het
Lrrk1	A	T	7: 66,287,615	C930S	probably damaging	Het
Lvrn	C	T	18: 46,850,328	S46L	possibly damaging	Het
Mcidas	G	A	13: 112,997,425	V148I	probably benign	Het
Mprip	A	T	11: 59,758,487	T1006S	probably benign	Het
Mrgprb3	T	A	7: 48,643,486	M106L	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mtor	G	A	4: 148,538,276	V1938I	possibly damaging	Het
Muc2	A	G	7: 141,691,203	D46G	probably damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Olfr1113	T	A	2: 87,213,739	F282L	probably benign	Het
Olfr811	A	T	10: 129,801,767	C253S	probably damaging	Het
Osbp2	C	T	11: 3,863,356	G171D	probably benign	Het
Otud6b	A	T	4: 14,818,187	M238K	possibly damaging	Het
Pcdhac2	G	A	18: 37,146,423	G819R	probably benign	Het
Pcdhac2	G	T	18: 37,146,424	G819V	probably benign	Het
Pcdhga12	T	G	18: 37,768,079	S655A	probably damaging	Het
Pkd1l3	A	G	8: 109,630,210	I756V	probably benign	Het
Plekhd1	T	A	12: 80,720,590	S251T	probably damaging	Het
Ppp2r1a	A	T	17: 20,958,987	T96S	probably benign	Het
Qser1	A	C	2: 104,789,694	S258A	possibly damaging	Het
Sass6	T	A	3: 116,607,486	C159S	probably benign	Het
Scaf4	T	C	16: 90,251,960	Q322R	unknown	Het
Sema6d	C	T	2: 124,656,901	H244Y	probably damaging	Het
Sigirr	T	G	7: 141,092,719	L163F	probably damaging	Het
Spata31d1c	C	A	13: 65,035,264	L207I	possibly damaging	Het
Tacstd2	A	G	6: 67,535,049	F220L	probably damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Tnxb	C	A	17: 34,683,418	Q1082K	probably damaging	Het
Trim41	GCCTAGGCGCCCA	G	11: 48,807,365		probably benign	Het
Trpm6	C	T	19: 18,829,933	R1014C	probably damaging	Het
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r61	A	G	7: 42,300,493	E779G	probably damaging	Het
Vmn2r61	T	A	7: 42,267,253	M430K	probably benign	Het
Zfp599	T	C	9: 22,253,869	D70G	probably benign	Het
Zmym1	A	T	4: 127,049,398	I301N	probably damaging	Het

Other mutations in Rsph4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Rsph4a	APN	10	33914343	missense	probably damaging	1.00
IGL00536:Rsph4a	APN	10	33911656	splice site	probably benign
IGL00702:Rsph4a	APN	10	33913072	missense	probably damaging	0.99
IGL02313:Rsph4a	APN	10	33905525	missense	possibly damaging	0.56
IGL02556:Rsph4a	APN	10	33905152	utr 5 prime	probably benign
PIT4519001:Rsph4a	UTSW	10	33909130	missense	probably benign	0.09
R0006:Rsph4a	UTSW	10	33909148	missense	probably damaging	1.00
R0006:Rsph4a	UTSW	10	33909148	missense	probably damaging	1.00
R0088:Rsph4a	UTSW	10	33909353	missense	probably benign	0.15
R0513:Rsph4a	UTSW	10	33912991	nonsense	probably null
R1559:Rsph4a	UTSW	10	33909731	missense	probably damaging	0.99
R1589:Rsph4a	UTSW	10	33905529	missense	probably benign	0.01
R1783:Rsph4a	UTSW	10	33911636	missense	probably damaging	1.00
R1914:Rsph4a	UTSW	10	33913072	missense	probably damaging	0.99
R2046:Rsph4a	UTSW	10	33914543	unclassified	probably benign
R2280:Rsph4a	UTSW	10	33911599	missense	probably benign	0.00
R2496:Rsph4a	UTSW	10	33908098	missense	possibly damaging	0.87
R3084:Rsph4a	UTSW	10	33909202	missense	probably damaging	1.00
R3086:Rsph4a	UTSW	10	33909202	missense	probably damaging	1.00
R4519:Rsph4a	UTSW	10	33911627	nonsense	probably null
R4965:Rsph4a	UTSW	10	33909240	missense	probably damaging	1.00
R5077:Rsph4a	UTSW	10	33908279	missense	probably damaging	1.00
R5264:Rsph4a	UTSW	10	33909383	missense	probably damaging	1.00
R5359:Rsph4a	UTSW	10	33908236	missense	probably benign	0.08
R5464:Rsph4a	UTSW	10	33909341	missense	possibly damaging	0.64
R5751:Rsph4a	UTSW	10	33905793	missense	probably damaging	0.99
R5763:Rsph4a	UTSW	10	33905688	missense	probably damaging	0.98
R5832:Rsph4a	UTSW	10	33909502	missense	probably benign	0.01
R6243:Rsph4a	UTSW	10	33909143	missense	probably damaging	1.00
R6654:Rsph4a	UTSW	10	33912992	missense	probably benign
R6918:Rsph4a	UTSW	10	33905276	missense	probably benign	0.00
R7081:Rsph4a	UTSW	10	33909193	missense	probably damaging	0.97
R7453:Rsph4a	UTSW	10	33909293	missense	probably benign	0.00
R7611:Rsph4a	UTSW	10	33905477	missense	probably benign	0.15
R7670:Rsph4a	UTSW	10	33909033	missense	probably damaging	1.00
R8017:Rsph4a	UTSW	10	33909459	missense	probably damaging	1.00
R8495:Rsph4a	UTSW	10	33905492	missense	probably benign	0.00
R8806:Rsph4a	UTSW	10	33909449	missense	probably damaging	0.99
R8884:Rsph4a	UTSW	10	33905844	splice site	probably benign
R9171:Rsph4a	UTSW	10	33909442	nonsense	probably null
R9269:Rsph4a	UTSW	10	33909398	missense	probably benign
R9392:Rsph4a	UTSW	10	33905240	missense	probably benign	0.24
X0057:Rsph4a	UTSW	10	33905727	missense	possibly damaging	0.58
X0066:Rsph4a	UTSW	10	33913009	missense	possibly damaging	0.94
Z1176:Rsph4a	UTSW	10	33911643	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAATCCAAAGATGTCGCTTC -3'
(R):5'- TGCTCTCATTTCCTGGGAAGG -3'

Sequencing Primer
(F):5'- ATCCAAAGATGTCGCTTCTGGGG -3'
(R):5'- AGGGTGGGTAGCTTATGACAGC -3'

Posted On

2016-10-26