Mutagenetix > Incidental Mutations

Incidental Mutation 'R5615:Ankrd17'

438180

Institutional Source

Beutler Lab

Gene Symbol

Ankrd17

Ensembl Gene

ENSMUSG00000055204

Gene Name

ankyrin repeat domain 17

Synonyms

A130069E23Rik, 4933425K22Rik, Gtar

Accession Numbers

Genbank: NM_030886, NM_198010; MGI: 1932101

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5615 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90227166-90366577 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90283436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 830 (S830T)

Ref Sequence

ENSEMBL: ENSMUSP00000151446 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014421] [ENSMUST00000081914] [ENSMUST00000168058] [ENSMUST00000197021] [ENSMUST00000218526]

AlphaFold

Q99NH0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014421
AA Change: S830T

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000014421
Gene: ENSMUSG00000055204
AA Change: S830T

Domain	Start	End	E-Value	Type
low complexity region	6	40	N/A	INTRINSIC
low complexity region	55	71	N/A	INTRINSIC
low complexity region	82	130	N/A	INTRINSIC
ANK	229	258	8.62e1	SMART
ANK	262	291	3.31e-1	SMART
ANK	296	325	3.51e-5	SMART
ANK	329	358	1.33e-5	SMART
ANK	362	391	3.46e-4	SMART
ANK	396	425	3.23e-4	SMART
ANK	429	458	1.61e-4	SMART
ANK	462	491	1.46e-2	SMART
ANK	495	524	3.88e-7	SMART
ANK	529	558	4.19e-3	SMART
ANK	559	588	1.76e-5	SMART
ANK	592	621	3.51e-5	SMART
ANK	625	654	5.62e-4	SMART
ANK	659	688	1.29e-3	SMART
ANK	692	721	1.44e-1	SMART
coiled coil region	800	883	N/A	INTRINSIC
low complexity region	890	903	N/A	INTRINSIC
low complexity region	955	968	N/A	INTRINSIC
low complexity region	986	997	N/A	INTRINSIC
low complexity region	1046	1060	N/A	INTRINSIC
ANK	1078	1107	2.13e-4	SMART
ANK	1111	1140	8.19e-6	SMART
ANK	1145	1174	1.68e-2	SMART
ANK	1178	1207	1.61e-4	SMART
ANK	1213	1242	1.43e-5	SMART
ANK	1247	1276	1.83e-3	SMART
ANK	1280	1309	3.91e-3	SMART
ANK	1315	1344	1.93e-2	SMART
ANK	1348	1377	8.78e-6	SMART
ANK	1381	1410	7.59e-1	SMART
coiled coil region	1454	1522	N/A	INTRINSIC
low complexity region	1597	1611	N/A	INTRINSIC
low complexity region	1616	1636	N/A	INTRINSIC
KH	1720	1790	8.31e-14	SMART
low complexity region	1816	1827	N/A	INTRINSIC
low complexity region	1834	1850	N/A	INTRINSIC
low complexity region	1946	1989	N/A	INTRINSIC
low complexity region	1996	2024	N/A	INTRINSIC
low complexity region	2035	2052	N/A	INTRINSIC
low complexity region	2068	2077	N/A	INTRINSIC
low complexity region	2086	2110	N/A	INTRINSIC
low complexity region	2175	2189	N/A	INTRINSIC
low complexity region	2348	2365	N/A	INTRINSIC
low complexity region	2392	2411	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081914

SMART Domains

Protein: ENSMUSP00000080587
Gene: ENSMUSG00000055204

Domain	Start	End	E-Value	Type
low complexity region	6	40	N/A	INTRINSIC
low complexity region	55	71	N/A	INTRINSIC
low complexity region	82	130	N/A	INTRINSIC
ANK	229	258	8.62e1	SMART
ANK	262	291	3.31e-1	SMART
ANK	296	325	3.51e-5	SMART
ANK	329	358	1.33e-5	SMART
ANK	362	391	3.46e-4	SMART
ANK	396	425	3.23e-4	SMART
ANK	429	458	1.61e-4	SMART
ANK	462	491	1.46e-2	SMART
ANK	495	524	3.88e-7	SMART
ANK	529	558	4.19e-3	SMART
ANK	559	588	1.76e-5	SMART
ANK	592	621	3.51e-5	SMART
ANK	625	654	5.62e-4	SMART
ANK	659	688	1.29e-3	SMART
ANK	692	721	1.44e-1	SMART
low complexity region	795	809	N/A	INTRINSIC
ANK	827	856	2.13e-4	SMART
ANK	860	889	8.19e-6	SMART
ANK	894	923	1.68e-2	SMART
ANK	927	956	1.61e-4	SMART
ANK	962	991	1.43e-5	SMART
ANK	996	1025	1.83e-3	SMART
ANK	1029	1058	3.91e-3	SMART
ANK	1064	1093	1.93e-2	SMART
ANK	1097	1126	8.78e-6	SMART
ANK	1130	1159	7.59e-1	SMART
coiled coil region	1203	1271	N/A	INTRINSIC
low complexity region	1346	1360	N/A	INTRINSIC
low complexity region	1365	1385	N/A	INTRINSIC
KH	1469	1539	8.31e-14	SMART
low complexity region	1565	1576	N/A	INTRINSIC
low complexity region	1583	1599	N/A	INTRINSIC
low complexity region	1695	1738	N/A	INTRINSIC
low complexity region	1745	1773	N/A	INTRINSIC
low complexity region	1784	1801	N/A	INTRINSIC
low complexity region	1817	1826	N/A	INTRINSIC
low complexity region	1835	1859	N/A	INTRINSIC
low complexity region	1924	1938	N/A	INTRINSIC
low complexity region	2097	2114	N/A	INTRINSIC
low complexity region	2141	2160	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000168058
AA Change: S830T

SMART Domains

Protein: ENSMUSP00000128960
Gene: ENSMUSG00000055204
AA Change: S830T

Domain	Start	End	E-Value	Type
low complexity region	6	40	N/A	INTRINSIC
low complexity region	55	71	N/A	INTRINSIC
low complexity region	82	130	N/A	INTRINSIC
ANK	229	258	8.62e1	SMART
ANK	262	291	3.31e-1	SMART
ANK	296	325	3.51e-5	SMART
ANK	329	358	1.33e-5	SMART
ANK	362	391	3.46e-4	SMART
ANK	396	425	3.23e-4	SMART
ANK	429	458	1.61e-4	SMART
ANK	462	491	1.46e-2	SMART
ANK	495	524	3.88e-7	SMART
ANK	529	558	4.19e-3	SMART
ANK	559	588	1.76e-5	SMART
ANK	592	621	3.51e-5	SMART
ANK	625	654	5.62e-4	SMART
ANK	659	688	1.29e-3	SMART
ANK	692	721	1.44e-1	SMART
coiled coil region	800	883	N/A	INTRINSIC
low complexity region	890	903	N/A	INTRINSIC
low complexity region	955	968	N/A	INTRINSIC
low complexity region	986	997	N/A	INTRINSIC
low complexity region	1046	1060	N/A	INTRINSIC
ANK	1078	1107	2.13e-4	SMART
ANK	1111	1140	8.19e-6	SMART
ANK	1145	1174	1.68e-2	SMART
ANK	1178	1207	1.61e-4	SMART
ANK	1213	1242	1.43e-5	SMART
ANK	1247	1276	1.83e-3	SMART
ANK	1280	1309	3.91e-3	SMART
ANK	1315	1344	1.93e-2	SMART
ANK	1348	1377	8.78e-6	SMART
ANK	1381	1410	7.59e-1	SMART
coiled coil region	1454	1522	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000197021
AA Change: S721T

SMART Domains

Protein: ENSMUSP00000142575
Gene: ENSMUSG00000055204
AA Change: S721T

Domain	Start	End	E-Value	Type
ANK	120	149	5.4e-1	SMART
ANK	153	182	2e-3	SMART
ANK	187	216	2.2e-7	SMART
ANK	220	249	8.2e-8	SMART
ANK	253	282	2.2e-6	SMART
ANK	287	316	2.1e-6	SMART
ANK	320	349	9.9e-7	SMART
ANK	353	382	9.5e-5	SMART
ANK	386	415	2.4e-9	SMART
ANK	420	449	2.6e-5	SMART
ANK	450	479	1.1e-7	SMART
ANK	483	512	2.2e-7	SMART
ANK	516	545	3.5e-6	SMART
ANK	550	579	7.9e-6	SMART
ANK	583	612	8.9e-4	SMART
coiled coil region	691	774	N/A	INTRINSIC
low complexity region	781	794	N/A	INTRINSIC
low complexity region	846	859	N/A	INTRINSIC
low complexity region	877	888	N/A	INTRINSIC
low complexity region	937	951	N/A	INTRINSIC
ANK	969	998	1.4e-6	SMART
ANK	1002	1031	5.3e-8	SMART
ANK	1036	1065	1e-4	SMART
ANK	1069	1098	1e-6	SMART
ANK	1104	1133	9.1e-8	SMART
ANK	1138	1167	1.2e-5	SMART
ANK	1171	1200	2.5e-5	SMART
ANK	1206	1235	1.2e-4	SMART
ANK	1239	1268	5.5e-8	SMART
ANK	1272	1301	4.7e-3	SMART
coiled coil region	1345	1413	N/A	INTRINSIC
low complexity region	1488	1502	N/A	INTRINSIC
low complexity region	1507	1527	N/A	INTRINSIC
KH	1611	1681	5.1e-16	SMART
low complexity region	1707	1718	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1837	1880	N/A	INTRINSIC
low complexity region	1887	1915	N/A	INTRINSIC
low complexity region	1926	1943	N/A	INTRINSIC
low complexity region	1959	1968	N/A	INTRINSIC
low complexity region	1977	2001	N/A	INTRINSIC
low complexity region	2066	2080	N/A	INTRINSIC
low complexity region	2239	2256	N/A	INTRINSIC
low complexity region	2283	2302	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199965

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200012

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218526
AA Change: S830T

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

MGI Phenotype

Strain: 4360512
Lethality: E10-E12
FUNCTION: This gene encodes a protein with ankyrin repeats, which are associated with protein-protein interactions. Studies suggest that this protein is involved in liver development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with hemorrhages, impaired vascular smooth muscle cell development, impaired vascular integrity, and growth retardation. [provided by MGI curators]

Allele List at MGI

All alleles(133) : Targeted(4) Gene trapped(129)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,606,759	L407H	probably damaging	Het
Abca12	A	T	1: 71,307,059	L884H	probably damaging	Het
Ahr	A	G	12: 35,503,885	V745A	probably benign	Het
Aox1	A	G	1: 58,096,966	T1123A	probably benign	Het
Arhgef11	T	C	3: 87,722,485		probably null	Het
Bcas3	T	A	11: 85,470,761	C250S	probably damaging	Het
Bckdk	T	C	7: 127,907,317	I272T	probably damaging	Het
Cacna1e	T	C	1: 154,412,170	K1897E	probably damaging	Het
Cd180	A	T	13: 102,706,203	I586F	probably benign	Het
Cep290	A	G	10: 100,531,150	D1121G	probably damaging	Het
Clasrp	A	G	7: 19,586,447		probably benign	Het
Col27a1	G	T	4: 63,281,114	K912N	probably damaging	Het
Dock4	G	T	12: 40,649,480	R231L	probably benign	Het
Ell	G	A	8: 70,590,732	S505N	probably benign	Het
Ephb6	A	G	6: 41,619,291	T833A	probably benign	Het
Hemk1	T	A	9: 107,330,824		probably null	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hspa12a	T	C	19: 58,804,650	I368V	possibly damaging	Het
Igkv3-3	A	T	6: 70,687,230	T19S	probably benign	Het
Itpr1	G	A	6: 108,488,600	A2158T	possibly damaging	Het
Lancl2	T	C	6: 57,722,511	Y104H	probably damaging	Het
Leng8	G	T	7: 4,144,958	E634*	probably null	Het
Lrrk1	A	T	7: 66,287,615	C930S	probably damaging	Het
Lvrn	C	T	18: 46,850,328	S46L	possibly damaging	Het
Mcidas	G	A	13: 112,997,425	V148I	probably benign	Het
Mprip	A	T	11: 59,758,487	T1006S	probably benign	Het
Mrgprb3	T	A	7: 48,643,486	M106L	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mtor	G	A	4: 148,538,276	V1938I	possibly damaging	Het
Muc2	A	G	7: 141,691,203	D46G	probably damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Olfr1113	T	A	2: 87,213,739	F282L	probably benign	Het
Olfr811	A	T	10: 129,801,767	C253S	probably damaging	Het
Osbp2	C	T	11: 3,863,356	G171D	probably benign	Het
Otud6b	A	T	4: 14,818,187	M238K	possibly damaging	Het
Pcdhac2	G	A	18: 37,146,423	G819R	probably benign	Het
Pcdhac2	G	T	18: 37,146,424	G819V	probably benign	Het
Pcdhga12	T	G	18: 37,768,079	S655A	probably damaging	Het
Pkd1l3	A	G	8: 109,630,210	I756V	probably benign	Het
Plekhd1	T	A	12: 80,720,590	S251T	probably damaging	Het
Ppp2r1a	A	T	17: 20,958,987	T96S	probably benign	Het
Qser1	A	C	2: 104,789,694	S258A	possibly damaging	Het
Rsph4a	G	A	10: 33,909,328	A412T	probably benign	Het
Sass6	T	A	3: 116,607,486	C159S	probably benign	Het
Scaf4	T	C	16: 90,251,960	Q322R	unknown	Het
Sema6d	C	T	2: 124,656,901	H244Y	probably damaging	Het
Sigirr	T	G	7: 141,092,719	L163F	probably damaging	Het
Spata31d1c	C	A	13: 65,035,264	L207I	possibly damaging	Het
Tacstd2	A	G	6: 67,535,049	F220L	probably damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Tnxb	C	A	17: 34,683,418	Q1082K	probably damaging	Het
Trim41	GCCTAGGCGCCCA	G	11: 48,807,365		probably benign	Het
Trpm6	C	T	19: 18,829,933	R1014C	probably damaging	Het
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r61	A	G	7: 42,300,493	E779G	probably damaging	Het
Vmn2r61	T	A	7: 42,267,253	M430K	probably benign	Het
Zfp599	T	C	9: 22,253,869	D70G	probably benign	Het
Zmym1	A	T	4: 127,049,398	I301N	probably damaging	Het

Other mutations in Ankrd17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ankrd17	APN	5	90233928	missense	probably damaging	0.98
IGL00484:Ankrd17	APN	5	90268361	missense	probably damaging	0.99
IGL01320:Ankrd17	APN	5	90260129	missense	probably damaging	0.99
IGL01776:Ankrd17	APN	5	90283364	nonsense	probably null
IGL02093:Ankrd17	APN	5	90242963	missense	possibly damaging	0.93
IGL02292:Ankrd17	APN	5	90252859	unclassified	probably benign
IGL02302:Ankrd17	APN	5	90283198	missense	probably benign	0.23
IGL02472:Ankrd17	APN	5	90264151	missense	probably damaging	1.00
IGL02705:Ankrd17	APN	5	90283115	missense	probably benign	0.15
IGL02727:Ankrd17	APN	5	90244292	missense	possibly damaging	0.93
IGL02884:Ankrd17	APN	5	90264757	missense	probably damaging	1.00
3-1:Ankrd17	UTSW	5	90243154	missense	probably damaging	0.99
PIT1430001:Ankrd17	UTSW	5	90252973	missense	possibly damaging	0.91
R0025:Ankrd17	UTSW	5	90250405	missense	probably damaging	0.99
R0076:Ankrd17	UTSW	5	90244406	nonsense	probably null
R0076:Ankrd17	UTSW	5	90244406	nonsense	probably null
R0271:Ankrd17	UTSW	5	90254799	missense	possibly damaging	0.90
R0684:Ankrd17	UTSW	5	90263998	missense	probably damaging	0.99
R1239:Ankrd17	UTSW	5	90288676	missense	probably damaging	0.99
R1457:Ankrd17	UTSW	5	90285846	missense	possibly damaging	0.92
R1505:Ankrd17	UTSW	5	90300026	missense	possibly damaging	0.53
R1766:Ankrd17	UTSW	5	90264797	missense	possibly damaging	0.95
R1770:Ankrd17	UTSW	5	90243376	missense	possibly damaging	0.84
R1780:Ankrd17	UTSW	5	90232415	missense	probably damaging	0.96
R1916:Ankrd17	UTSW	5	90260141	missense	probably damaging	1.00
R1926:Ankrd17	UTSW	5	90244169	missense	probably damaging	1.00
R2090:Ankrd17	UTSW	5	90298046	missense	possibly damaging	0.92
R2153:Ankrd17	UTSW	5	90234059	missense	probably damaging	0.98
R2279:Ankrd17	UTSW	5	90264717	missense	probably damaging	1.00
R2420:Ankrd17	UTSW	5	90289320	missense	possibly damaging	0.94
R3012:Ankrd17	UTSW	5	90230868	missense	probably damaging	1.00
R3417:Ankrd17	UTSW	5	90243913	missense	possibly damaging	0.86
R3704:Ankrd17	UTSW	5	90243969	missense	possibly damaging	0.72
R4581:Ankrd17	UTSW	5	90283120	missense	possibly damaging	0.67
R4850:Ankrd17	UTSW	5	90264786	missense	probably damaging	1.00
R4926:Ankrd17	UTSW	5	90300032	missense	probably damaging	1.00
R5023:Ankrd17	UTSW	5	90282868	missense	probably damaging	1.00
R5068:Ankrd17	UTSW	5	90254808	missense	probably damaging	0.96
R5109:Ankrd17	UTSW	5	90243536	missense	possibly damaging	0.83
R5111:Ankrd17	UTSW	5	90242999	missense	possibly damaging	0.85
R5214:Ankrd17	UTSW	5	90283460	missense	possibly damaging	0.48
R5362:Ankrd17	UTSW	5	90265545	missense	probably damaging	1.00
R5576:Ankrd17	UTSW	5	90243224	missense	probably benign	0.00
R5874:Ankrd17	UTSW	5	90268797	intron	probably benign
R5932:Ankrd17	UTSW	5	90265436	missense	probably damaging	1.00
R5944:Ankrd17	UTSW	5	90285843	missense	probably damaging	1.00
R5993:Ankrd17	UTSW	5	90339672	intron	probably benign
R6052:Ankrd17	UTSW	5	90253832	missense	probably benign	0.03
R6088:Ankrd17	UTSW	5	90253688	missense	possibly damaging	0.95
R6306:Ankrd17	UTSW	5	90244154	missense	probably benign	0.03
R6418:Ankrd17	UTSW	5	90278345	missense	possibly damaging	0.89
R6663:Ankrd17	UTSW	5	90264064	missense	probably damaging	1.00
R6758:Ankrd17	UTSW	5	90263313	missense	probably damaging	1.00
R6782:Ankrd17	UTSW	5	90254738	missense	possibly damaging	0.91
R6793:Ankrd17	UTSW	5	90265512	missense	probably damaging	1.00
R6929:Ankrd17	UTSW	5	90285525	missense	possibly damaging	0.86
R7008:Ankrd17	UTSW	5	90260096	missense	possibly damaging	0.93
R7051:Ankrd17	UTSW	5	90366451	unclassified	probably benign
R7077:Ankrd17	UTSW	5	90285864	missense	possibly damaging	0.92
R7134:Ankrd17	UTSW	5	90232314	missense	probably damaging	0.99
R7134:Ankrd17	UTSW	5	90285523	missense	probably benign	0.03
R7138:Ankrd17	UTSW	5	90242977	missense	probably benign	0.38
R7143:Ankrd17	UTSW	5	90285961	missense	possibly damaging	0.85
R7173:Ankrd17	UTSW	5	90260117	missense	possibly damaging	0.95
R7176:Ankrd17	UTSW	5	90268735	missense	probably damaging	0.99
R7365:Ankrd17	UTSW	5	90291151	missense	possibly damaging	0.45
R7390:Ankrd17	UTSW	5	90282920	missense	probably benign	0.13
R7430:Ankrd17	UTSW	5	90295657	missense	possibly damaging	0.80
R7468:Ankrd17	UTSW	5	90243043	missense	probably benign
R7483:Ankrd17	UTSW	5	90299996	missense	probably benign	0.00
R7492:Ankrd17	UTSW	5	90233948	missense	possibly damaging	0.85
R7610:Ankrd17	UTSW	5	90232363	missense	possibly damaging	0.93
R7636:Ankrd17	UTSW	5	90232380	missense	possibly damaging	0.53
R7790:Ankrd17	UTSW	5	90260152	missense	possibly damaging	0.61
R7839:Ankrd17	UTSW	5	90263354	missense	probably damaging	0.97
R7853:Ankrd17	UTSW	5	90238966	missense	possibly damaging	0.91
R7976:Ankrd17	UTSW	5	90283592	nonsense	probably null
R8054:Ankrd17	UTSW	5	90291055	missense	probably benign	0.43
R8230:Ankrd17	UTSW	5	90243976	missense	possibly damaging	0.86
R8274:Ankrd17	UTSW	5	90282859	missense	probably benign	0.15
R8365:Ankrd17	UTSW	5	90250519	missense	possibly damaging	0.95
R8532:Ankrd17	UTSW	5	90264820	missense	probably damaging	1.00
R8729:Ankrd17	UTSW	5	90295593	missense	probably benign
R8812:Ankrd17	UTSW	5	90293203	missense	probably benign	0.09
R8933:Ankrd17	UTSW	5	90258466	missense	probably damaging	0.99
R9051:Ankrd17	UTSW	5	90263275	missense	probably damaging	0.99
R9055:Ankrd17	UTSW	5	90232309	missense	probably benign	0.33
R9136:Ankrd17	UTSW	5	90244419	missense	probably damaging	0.96
R9158:Ankrd17	UTSW	5	90268716	missense	probably damaging	1.00
R9201:Ankrd17	UTSW	5	90230939	missense	possibly damaging	0.84
R9315:Ankrd17	UTSW	5	90250501	missense	probably damaging	0.97
R9364:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9366:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9368:Ankrd17	UTSW	5	90244127	missense	possibly damaging	0.91
R9368:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9369:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9381:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
X0019:Ankrd17	UTSW	5	90298654	missense	probably damaging	1.00
Z1177:Ankrd17	UTSW	5	90283505	missense	possibly damaging	0.83
Z1177:Ankrd17	UTSW	5	90289325	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- TCGGAAAGCTGCTCTCCAAC -3'
(R):5'- ATTCACGTGCACTTCTGAGGG -3'

Sequencing Primer
(F):5'- CCAGATGCTGGCAAGACTGTTG -3'
(R):5'- AGGGGGTTTCTTTTTCACACAGC -3'

Posted On

2016-10-26