Incidental Mutation 'R5941:Grin2b'
ID460255
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 044133-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5941 (G1)
Quality Score109
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 135736373 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 837 (I837L)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: I837L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: I837L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: I837L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: I837L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158638
Meta Mutation Damage Score 0.1852 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,591,098 D70E probably damaging Het
Adamts14 C T 10: 61,221,895 G561R probably damaging Het
Alpk3 A T 7: 81,078,653 K510N probably damaging Het
Ap3b1 A G 13: 94,440,273 N269D probably benign Het
Ap3b1 T C 13: 94,483,265 S144P probably damaging Het
Apba2 C A 7: 64,745,716 Q635K probably benign Het
Aspg C T 12: 112,113,085 T99I probably benign Het
Atp7b A G 8: 21,997,496 V1179A probably damaging Het
Bbs12 T C 3: 37,320,048 V215A probably damaging Het
Bcl2l11 C A 2: 128,127,783 probably benign Het
Bglap3 T G 3: 88,376,346 probably benign Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cdh26 C T 2: 178,481,650 Q662* probably null Het
Cftr T A 6: 18,313,646 F1290I probably damaging Het
Clip3 G A 7: 30,292,306 E36K probably damaging Het
Cog2 A G 8: 124,546,086 I541V probably benign Het
Cpt1b A T 15: 89,425,214 W39R probably damaging Het
Csmd1 A G 8: 15,932,471 V2732A probably damaging Het
Dlec1 A G 9: 119,126,312 D688G probably damaging Het
Dnah12 A G 14: 26,706,867 E216G probably benign Het
Dnah7b C A 1: 46,187,290 L1294I probably damaging Het
Duox1 T A 2: 122,344,156 L1265Q probably damaging Het
Fam91a1 T A 15: 58,431,317 D358E probably benign Het
Fat3 A C 9: 15,999,501 I1735S probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabrr1 T A 4: 33,162,676 M414K probably benign Het
Gm21915 A C 9: 40,670,699 E29D possibly damaging Het
Gm340 G A 19: 41,586,400 R1198Q probably damaging Het
Gm9955 G A 18: 24,709,263 probably benign Het
Gpat2 C A 2: 127,428,275 D69E possibly damaging Het
Gucy2g T C 19: 55,215,131 D745G probably damaging Het
H2-Q1 A G 17: 35,321,356 Y139C probably damaging Het
Ints2 G C 11: 86,250,972 N216K probably benign Het
Jmy G A 13: 93,498,825 P161L probably benign Het
Kctd11 G A 11: 69,879,973 R80W possibly damaging Het
Kif7 A G 7: 79,711,132 probably benign Het
Kifc1 C T 17: 33,883,085 probably benign Het
Mir412 C A 12: 109,743,299 noncoding transcript Het
Mknk1 T A 4: 115,876,637 probably benign Het
Mmp16 A G 4: 18,054,354 probably benign Het
Mmp7 A G 9: 7,697,645 H227R probably damaging Het
Myh4 A C 11: 67,259,300 D1861A probably damaging Het
Nup205 T C 6: 35,232,408 L1550P probably damaging Het
Olfr1218 T A 2: 89,054,619 H269L probably benign Het
Olfr1510 C T 14: 52,410,068 G268D probably benign Het
Olfr444 G T 6: 42,955,716 A73S possibly damaging Het
Olfr48 T A 2: 89,844,515 I153F probably benign Het
Olfr609 A G 7: 103,492,720 S53P possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pafah1b2 A T 9: 45,976,107 C35* probably null Het
Pappa T A 4: 65,314,593 F1323Y possibly damaging Het
Phtf2 A T 5: 20,774,073 F519Y probably damaging Het
Pigk T C 3: 152,766,513 I354T possibly damaging Het
Plekha7 T C 7: 116,124,805 D1265G possibly damaging Het
Prss12 A G 3: 123,505,501 R641G probably benign Het
Prss28 A G 17: 25,309,743 Y53C probably damaging Het
Rabgap1 G T 2: 37,561,896 C936F possibly damaging Het
Rap1a T C 3: 105,732,069 I91M possibly damaging Het
Rap1gap2 A T 11: 74,392,237 M679K probably damaging Het
Rapgef5 T A 12: 117,728,738 L352I probably damaging Het
Rhbdl3 G A 11: 80,331,889 V255M probably benign Het
Rhot1 T C 11: 80,251,170 probably benign Het
Rita1 A C 5: 120,609,561 V224G probably benign Het
Ryr2 T A 13: 11,687,902 Y2900F probably damaging Het
Scaf11 A C 15: 96,420,308 H458Q probably damaging Het
Scamp4 T A 10: 80,612,421 S159T probably benign Het
Setd5 T A 6: 113,128,490 Y828N probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sipa1l2 A G 8: 125,473,536 S684P probably damaging Het
Stard9 A T 2: 120,713,558 I4446F probably damaging Het
Sult1c2 T C 17: 53,831,898 D217G probably benign Het
Supt16 C A 14: 52,182,196 K148N probably benign Het
Syne3 G A 12: 104,946,992 S570L probably benign Het
Tcf3 G T 10: 80,413,044 D534E probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trbv3 T C 6: 41,048,401 I3T probably benign Het
Trbv4 T A 6: 41,059,629 Y29* probably null Het
Ttl A G 2: 129,075,984 N122S probably benign Het
Txndc11 T C 16: 11,075,071 T932A probably benign Het
Ube2e2 G A 14: 18,586,910 A150V probably damaging Het
Ube2ql1 T C 13: 69,739,340 M1V probably null Het
Uqcrc1 A G 9: 108,947,486 probably benign Het
Utrn T C 10: 12,486,483 D2702G probably damaging Het
Vcan T A 13: 89,692,691 D618V probably damaging Het
Vdac3-ps1 A G 13: 18,031,202 noncoding transcript Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zap70 G A 1: 36,770,949 V47M probably damaging Het
Zfp770 A G 2: 114,197,546 M14T possibly damaging Het
Zufsp C T 10: 33,949,462 G8D probably damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTGGAACAAGCACCTTC -3'
(R):5'- TCACAAGGAAGTCCCATGTCC -3'

Sequencing Primer
(F):5'- TCTTGGTCTCTTTGCTGAGC -3'
(R):5'- AGGAAGTCCCATGTCCTTGAGTTAC -3'
Posted On2017-02-28