Mutagenetix > Incidental Mutations

Incidental Mutation 'R6114:Nr1h4'

485032

Institutional Source

Beutler Lab

Gene Symbol

Nr1h4

Ensembl Gene

ENSMUSG00000047638

Gene Name

nuclear receptor subfamily 1, group H, member 4

Synonyms

Rxrip14, FXR, HRR1, Fxr, RIP14

MMRRC Submission

044263-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.764) question?

Stock #

R6114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89454234-89533585 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89478816 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 273 (N273Y)

Ref Sequence

ENSEMBL: ENSMUSP00000053092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058126] [ENSMUST00000105296] [ENSMUST00000105297]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058126
AA Change: N273Y

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000053092
Gene: ENSMUSG00000047638
AA Change: N273Y

Domain	Start	End	E-Value	Type
ZnF_C4	135	206	1.93e-37	SMART
Blast:HOLI	235	285	4e-19	BLAST
HOLI	301	456	9.43e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105296
AA Change: N277Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000100933
Gene: ENSMUSG00000047638
AA Change: N277Y

Domain	Start	End	E-Value	Type
ZnF_C4	135	206	1.93e-37	SMART
Blast:HOLI	239	289	4e-19	BLAST
HOLI	305	460	9.43e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105297
AA Change: N263Y

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000100934
Gene: ENSMUSG00000047638
AA Change: N263Y

Domain	Start	End	E-Value	Type
ZnF_C4	121	192	1.93e-37	SMART
Blast:HOLI	225	275	3e-19	BLAST
HOLI	291	446	9.43e-32	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

94% (60/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit increased bile salts and abnormal liver morphology and physiology. Mice homozygous for one knock-out allele also exhibit abnormal lipid homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	C	A	14: 68,571,803	V237L	probably benign	Het
Aff1	T	C	5: 103,842,297	S878P	probably damaging	Het
Ahcy	A	C	2: 155,062,159	L386R	probably damaging	Het
Ank2	T	C	3: 127,011,051	N607D	probably damaging	Het
Arid5b	T	C	10: 68,097,744	D776G	possibly damaging	Het
Art4	T	A	6: 136,857,213	T11S	unknown	Het
Blm	T	C	7: 80,513,487	T39A	probably damaging	Het
Cabin1	T	A	10: 75,747,971	M221L	probably benign	Het
Cacna1c	T	C	6: 118,596,140	T1675A	probably benign	Het
Cacnb2	A	T	2: 14,975,201	H285L	possibly damaging	Het
Cchcr1	A	G	17: 35,525,330	E339G	probably damaging	Het
Cd14	A	G	18: 36,725,953	W150R	probably damaging	Het
Cep162	A	G	9: 87,203,710	I1187T	probably benign	Het
Cntnap4	A	G	8: 112,841,753	H807R	probably damaging	Het
Copb1	T	A	7: 114,246,801	H178L	probably benign	Het
Cpxm2	A	G	7: 132,154,306	V103A	probably benign	Het
Egfr	A	G	11: 16,904,374	T849A	possibly damaging	Het
Endou	T	A	15: 97,713,876	K294*	probably null	Het
Fam208b	G	A	13: 3,590,081	T352M	probably damaging	Het
Gm884	T	A	11: 103,617,791		probably benign	Het
Hoxd9	A	G	2: 74,699,365	N322D	probably damaging	Het
Hsph1	C	A	5: 149,627,387	V416L	possibly damaging	Het
Igkv4-78	T	A	6: 69,059,759	T97S	possibly damaging	Het
Itga10	G	T	3: 96,649,035	C162F	probably damaging	Het
Lmod2	A	G	6: 24,603,692	E222G	probably damaging	Het
Lpar5	A	G	6: 125,081,676	N120S	probably damaging	Het
Lrrk2	A	G	15: 91,747,826	I1318V	probably benign	Het
Lst1	T	C	17: 35,188,360	T11A	possibly damaging	Het
Mfn1	C	A	3: 32,563,836	A106D	probably damaging	Het
Ms4a12	G	T	19: 11,215,290	N227K	probably benign	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr355	A	T	2: 36,927,689	C142S	possibly damaging	Het
Olfr516	A	T	7: 108,845,386	M208K	possibly damaging	Het
Olfr771	T	A	10: 129,160,333	H217L	probably benign	Het
Pcdhgc3	C	G	18: 37,807,872	T442R	probably benign	Het
Pcnx2	T	C	8: 125,773,947	N1468S	probably damaging	Het
Pde2a	A	T	7: 101,511,112		probably null	Het
Pitx2	C	G	3: 129,204,413		probably null	Het
Reck	T	A	4: 43,922,895	I390N	probably damaging	Het
Rora	A	G	9: 69,371,323	N254S	probably benign	Het
Samd4b	A	G	7: 28,522,792		probably null	Het
Scn8a	A	G	15: 101,040,596	T1949A	probably damaging	Het
Slc22a15	A	T	3: 101,860,852	Y346*	probably null	Het
Slc24a5	A	G	2: 125,083,092	T218A	probably benign	Het
Slc38a10	G	A	11: 120,129,312	Q305*	probably null	Het
Slc45a4	G	A	15: 73,605,604	P28S	probably damaging	Het
Smyd5	A	T	6: 85,440,262		probably benign	Het
Sox8	T	C	17: 25,567,520	D403G	probably damaging	Het
Stx7	A	G	10: 24,184,985		probably null	Het
Svil	T	C	18: 5,108,639	S1522P	probably damaging	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tcf25	A	T	8: 123,384,375	K192M	probably damaging	Het
Tecpr1	C	T	5: 144,204,640	G804S	possibly damaging	Het
Teddm1a	C	G	1: 153,891,868	S26C	probably damaging	Het
Usp13	C	T	3: 32,854,669	P155S	probably damaging	Het
Usp17lb	T	A	7: 104,840,364	D451V	possibly damaging	Het
Vmn1r173	A	G	7: 23,702,829	N163S	possibly damaging	Het
Vmn2r103	G	T	17: 19,812,325	C787F	probably damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zbtb40	T	A	4: 136,988,691	I988F	probably damaging	Het
Zfp536	A	T	7: 37,479,736	I84N	probably damaging	Het
Zfp651	T	A	9: 121,765,595	F540Y	probably damaging	Het

Other mutations in Nr1h4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01701:Nr1h4	APN	10	89478807	missense	probably benign	0.42
IGL02628:Nr1h4	APN	10	89473839	missense	probably damaging	1.00
Aeronaut	UTSW	10	89498229	nonsense	probably null
I1329:Nr1h4	UTSW	10	89483362	splice site	probably benign
IGL02837:Nr1h4	UTSW	10	89516480	missense	probably benign	0.00
R0590:Nr1h4	UTSW	10	89456567	missense	probably damaging	0.99
R0645:Nr1h4	UTSW	10	89506528	missense	probably benign	0.08
R1887:Nr1h4	UTSW	10	89454867	missense	possibly damaging	0.64
R1905:Nr1h4	UTSW	10	89480559	missense	possibly damaging	0.85
R2471:Nr1h4	UTSW	10	89473894	missense	probably damaging	1.00
R2921:Nr1h4	UTSW	10	89498361	missense	probably damaging	1.00
R3177:Nr1h4	UTSW	10	89478788	missense	possibly damaging	0.89
R3277:Nr1h4	UTSW	10	89478788	missense	possibly damaging	0.89
R4656:Nr1h4	UTSW	10	89498253	missense	probably benign	0.00
R4676:Nr1h4	UTSW	10	89473874	missense	probably damaging	1.00
R4901:Nr1h4	UTSW	10	89478797	missense	possibly damaging	0.68
R4993:Nr1h4	UTSW	10	89498180	missense	probably benign	0.01
R5117:Nr1h4	UTSW	10	89478422	missense	probably damaging	1.00
R5131:Nr1h4	UTSW	10	89483455	missense	probably damaging	0.99
R5176:Nr1h4	UTSW	10	89498255	missense	probably benign	0.02
R5241:Nr1h4	UTSW	10	89483489	missense	probably damaging	1.00
R5580:Nr1h4	UTSW	10	89516440	missense	probably benign	0.16
R6814:Nr1h4	UTSW	10	89454745	missense	probably damaging	0.98
R6888:Nr1h4	UTSW	10	89456542	missense	probably damaging	1.00
R6990:Nr1h4	UTSW	10	89454930	missense	probably benign	0.18
R7141:Nr1h4	UTSW	10	89498229	nonsense	probably null
R7427:Nr1h4	UTSW	10	89498405	missense	probably benign	0.00
R7428:Nr1h4	UTSW	10	89498405	missense	probably benign	0.00
R7560:Nr1h4	UTSW	10	89498261	missense	probably benign
R7986:Nr1h4	UTSW	10	89454772	missense	possibly damaging	0.46
X0023:Nr1h4	UTSW	10	89454844	missense	possibly damaging	0.45
Z1176:Nr1h4	UTSW	10	89498350	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAGACCTGAGACTTCCTTTCCAATTG -3'
(R):5'- ACAGCTCTTGGAGGCTTTG -3'

Sequencing Primer
(F):5'- AGACTTCCTTTCCAATTGTTTAATGC -3'
(R):5'- GATCAGTGCACATACTGG -3'

Posted On

2017-08-16