Incidental Mutation 'R6114:Nr1h4'
ID485032
Institutional Source Beutler Lab
Gene Symbol Nr1h4
Ensembl Gene ENSMUSG00000047638
Gene Namenuclear receptor subfamily 1, group H, member 4
SynonymsRxrip14, FXR, HRR1, Fxr, RIP14
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location89454234-89533585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89478816 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 273 (N273Y)
Ref Sequence ENSEMBL: ENSMUSP00000053092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058126] [ENSMUST00000105296] [ENSMUST00000105297]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058126
AA Change: N273Y

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053092
Gene: ENSMUSG00000047638
AA Change: N273Y

DomainStartEndE-ValueType
ZnF_C4 135 206 1.93e-37 SMART
Blast:HOLI 235 285 4e-19 BLAST
HOLI 301 456 9.43e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105296
AA Change: N277Y

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000100933
Gene: ENSMUSG00000047638
AA Change: N277Y

DomainStartEndE-ValueType
ZnF_C4 135 206 1.93e-37 SMART
Blast:HOLI 239 289 4e-19 BLAST
HOLI 305 460 9.43e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105297
AA Change: N263Y

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000100934
Gene: ENSMUSG00000047638
AA Change: N263Y

DomainStartEndE-ValueType
ZnF_C4 121 192 1.93e-37 SMART
Blast:HOLI 225 275 3e-19 BLAST
HOLI 291 446 9.43e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit increased bile salts and abnormal liver morphology and physiology. Mice homozygous for one knock-out allele also exhibit abnormal lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Nr1h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Nr1h4 APN 10 89478807 missense probably benign 0.42
IGL02628:Nr1h4 APN 10 89473839 missense probably damaging 1.00
Aeronaut UTSW 10 89498229 nonsense probably null
I1329:Nr1h4 UTSW 10 89483362 splice site probably benign
IGL02837:Nr1h4 UTSW 10 89516480 missense probably benign 0.00
R0590:Nr1h4 UTSW 10 89456567 missense probably damaging 0.99
R0645:Nr1h4 UTSW 10 89506528 missense probably benign 0.08
R1887:Nr1h4 UTSW 10 89454867 missense possibly damaging 0.64
R1905:Nr1h4 UTSW 10 89480559 missense possibly damaging 0.85
R2471:Nr1h4 UTSW 10 89473894 missense probably damaging 1.00
R2921:Nr1h4 UTSW 10 89498361 missense probably damaging 1.00
R3177:Nr1h4 UTSW 10 89478788 missense possibly damaging 0.89
R3277:Nr1h4 UTSW 10 89478788 missense possibly damaging 0.89
R4656:Nr1h4 UTSW 10 89498253 missense probably benign 0.00
R4676:Nr1h4 UTSW 10 89473874 missense probably damaging 1.00
R4901:Nr1h4 UTSW 10 89478797 missense possibly damaging 0.68
R4993:Nr1h4 UTSW 10 89498180 missense probably benign 0.01
R5117:Nr1h4 UTSW 10 89478422 missense probably damaging 1.00
R5131:Nr1h4 UTSW 10 89483455 missense probably damaging 0.99
R5176:Nr1h4 UTSW 10 89498255 missense probably benign 0.02
R5241:Nr1h4 UTSW 10 89483489 missense probably damaging 1.00
R5580:Nr1h4 UTSW 10 89516440 missense probably benign 0.16
R6814:Nr1h4 UTSW 10 89454745 missense probably damaging 0.98
R6888:Nr1h4 UTSW 10 89456542 missense probably damaging 1.00
R6990:Nr1h4 UTSW 10 89454930 missense probably benign 0.18
R7141:Nr1h4 UTSW 10 89498229 nonsense probably null
R7427:Nr1h4 UTSW 10 89498405 missense probably benign 0.00
R7428:Nr1h4 UTSW 10 89498405 missense probably benign 0.00
R7560:Nr1h4 UTSW 10 89498261 missense probably benign
X0023:Nr1h4 UTSW 10 89454844 missense possibly damaging 0.45
Z1176:Nr1h4 UTSW 10 89498350 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGACCTGAGACTTCCTTTCCAATTG -3'
(R):5'- ACAGCTCTTGGAGGCTTTG -3'

Sequencing Primer
(F):5'- AGACTTCCTTTCCAATTGTTTAATGC -3'
(R):5'- GATCAGTGCACATACTGG -3'
Posted On2017-08-16