Incidental Mutation 'R7032:Ice1'
ID546404
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Nameinteractor of little elongation complex ELL subunit 1
SynonymsBC018507
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R7032 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location70551707-70637634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70596164 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 2100 (N2100S)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637]
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: N2100S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: N2100S

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T G 8: 45,956,437 S282R probably damaging Het
2310003L06Rik T A 5: 87,972,579 D398E possibly damaging Het
Adam34 T C 8: 43,652,266 Y114C probably damaging Het
Akap9 T A 5: 3,954,896 D156E probably benign Het
Apba1 T A 19: 23,912,461 S408T probably benign Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atf6 A T 1: 170,799,612 probably null Het
Atp6v1b2 T A 8: 69,088,896 V35E probably benign Het
Atp8a2 T C 14: 60,017,840 probably null Het
Ccdc170 C A 10: 4,482,597 P12Q unknown Het
Cdh23 C T 10: 60,331,788 E1810K probably damaging Het
Cdo1 A T 18: 46,720,408 F94L probably damaging Het
Chdh C T 14: 30,036,852 P585S possibly damaging Het
Clasp2 A G 9: 113,854,323 N407S probably benign Het
Clca3a1 T A 3: 144,747,568 S465C probably benign Het
Clip2 C A 5: 134,522,630 V213L probably damaging Het
Col6a6 A G 9: 105,767,508 S1194P probably damaging Het
Cyp7a1 T C 4: 6,268,463 T421A possibly damaging Het
Dhh C T 15: 98,894,026 G367E possibly damaging Het
Dnah5 A G 15: 28,326,650 N2002D probably damaging Het
Epn2 T A 11: 61,546,702 N15Y probably damaging Het
Evi5 A C 5: 107,788,281 V647G probably benign Het
Eya1 T C 1: 14,283,200 probably null Het
Fam120a A G 13: 48,949,113 V222A probably benign Het
Fastkd5 A T 2: 130,615,944 I242K possibly damaging Het
Hnrnpul1 A G 7: 25,750,894 M131T probably benign Het
Ifi205 T A 1: 174,028,350 D38V possibly damaging Het
Klhl9 G A 4: 88,721,606 Q133* probably null Het
Krt84 T C 15: 101,528,489 E370G probably benign Het
Lrrc4c T C 2: 97,629,065 I12T probably benign Het
Lrriq4 T A 3: 30,655,701 L398* probably null Het
Ltf G A 9: 111,026,130 probably null Het
Macf1 C T 4: 123,472,308 V1322I probably benign Het
Mark2 T A 19: 7,287,333 I112L probably damaging Het
Mterf2 A T 10: 85,120,663 C32* probably null Het
Myo3b C T 2: 70,095,264 T25I probably damaging Het
Nsun7 A C 5: 66,264,035 I115L probably benign Het
Olfm3 G A 3: 115,090,156 V36M probably damaging Het
Olfr1174-ps T C 2: 88,311,029 T256A probably benign Het
Olfr147 A T 9: 38,403,669 Y262F possibly damaging Het
Olfr1537 A T 9: 39,237,687 S246T possibly damaging Het
Olfr406 T C 11: 74,269,602 I71T possibly damaging Het
Pcdhgb8 A T 18: 37,763,909 R677S probably benign Het
Prrt4 A C 6: 29,170,539 L638R possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab44 T C 17: 29,140,464 F542S unknown Het
Rhobtb3 T A 13: 75,872,394 E596D probably benign Het
Rpl36 T C 17: 56,613,944 I44T probably benign Het
Rptor A G 11: 119,846,936 I112V probably benign Het
Rrnad1 A G 3: 87,924,342 probably null Het
Rxfp2 T C 5: 150,070,348 I611T probably damaging Het
Slc12a4 G T 8: 105,949,233 N553K probably damaging Het
Spata31d1d T A 13: 59,728,232 R496S probably benign Het
Strbp T C 2: 37,603,113 D387G possibly damaging Het
Tas2r107 A T 6: 131,659,190 C299S possibly damaging Het
Tbc1d21 A T 9: 58,366,851 probably null Het
Tdrd12 A T 7: 35,481,046 Y847* probably null Het
Tlr2 A T 3: 83,837,905 N290K probably benign Het
Tmppe A G 9: 114,405,790 T386A probably damaging Het
Tnks1bp1 C A 2: 85,061,953 H741Q probably benign Het
Trpc6 G A 9: 8,609,950 V140M probably damaging Het
Ttn T C 2: 76,811,588 D13427G probably damaging Het
Uba7 C A 9: 107,976,172 L106I possibly damaging Het
Unc5b T G 10: 60,778,808 T237P probably damaging Het
Vit A C 17: 78,624,865 D467A probably damaging Het
Vmn1r103 T C 7: 20,509,855 Y227C possibly damaging Het
Vmn1r77 T A 7: 12,042,090 Y196* probably null Het
Zhx3 A G 2: 160,780,978 V423A probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGACTTGGACATTTTCAGG -3'
(R):5'- GCATAGCGTAAATGGCAGTCC -3'

Sequencing Primer
(F):5'- ACTTGGACATTTTCAGGCTACTTTTG -3'
(R):5'- GAATGCTCCTATAGATGTTGGAATCG -3'
Posted On2019-05-13