Mutagenetix > Incidental Mutations

Incidental Mutation 'R6853:Ice1'

535105

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R6853 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 70603302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 1555 (E1555A)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]

AlphaFold

E9Q286

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043493
AA Change: E1555A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: E1555A

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220637

Predicted Effect

probably benign
Transcript: ENSMUST00000222568

Predicted Effect

probably benign
Transcript: ENSMUST00000222627

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

98% (63/64)

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	G	T	15: 12,817,945	D138E	probably benign	Het
Atp13a5	A	G	16: 29,321,662	S359P	possibly damaging	Het
Bcam	T	C	7: 19,760,406	D355G	probably damaging	Het
Bmp8a	C	A	4: 123,342,683	W9L	unknown	Het
Cacul1	A	T	19: 60,529,466	Y334*	probably null	Het
Ccdc178	A	T	18: 22,109,876	N227K	probably benign	Het
Ceacam2	T	C	7: 25,518,136	N318S	possibly damaging	Het
Cntrl	T	A	2: 35,129,821	S553R	possibly damaging	Het
Ctsa	T	A	2: 164,837,364	M331K	probably benign	Het
Cyp2c38	T	A	19: 39,438,304	Q184H	probably benign	Het
Cyp2c70	C	T	19: 40,183,920	E93K	possibly damaging	Het
D430041D05Rik	C	T	2: 104,241,155	V1267M	probably damaging	Het
Ddias	C	T	7: 92,859,565	A381T	possibly damaging	Het
Dnhd1	G	A	7: 105,703,728	C2696Y	probably benign	Het
Efr3a	G	A	15: 65,829,830	V198I	probably benign	Het
Farp2	T	C	1: 93,570,016	F256S	probably damaging	Het
Fga	A	G	3: 83,030,912	Y198C	probably damaging	Het
Gabpa	T	A	16: 84,860,499	C421S	probably damaging	Het
Gm21798	A	T	15: 64,817,865		probably benign	Het
Gm21798	A	T	15: 64,817,867		probably benign	Het
Gm7145	A	C	1: 117,986,144	N252T	possibly damaging	Het
H2-Q6	T	C	17: 35,428,359	*327R	probably null	Het
H6pd	T	C	4: 149,982,462	D489G	probably benign	Het
Htra2	A	G	6: 83,053,831		probably benign	Het
Inpp5d	T	A	1: 87,681,680		probably null	Het
Itih2	T	C	2: 10,115,266	D320G	probably damaging	Het
Kif1a	T	G	1: 93,039,802	H1129P	possibly damaging	Het
Kmt2a	G	A	9: 44,818,407		probably benign	Het
L3mbtl4	G	A	17: 68,777,920	D609N	probably damaging	Het
Lgals9	A	T	11: 78,966,006	D248E	probably benign	Het
Lhx9	ACC	ACCC	1: 138,841,806		probably null	Het
Msh3	A	G	13: 92,312,572		probably null	Het
Mtus2	A	G	5: 148,107,011	K803R	probably damaging	Het
Oas1a	T	A	5: 120,907,428	I17L	possibly damaging	Het
Olfr1480	T	A	19: 13,529,931	I130K	possibly damaging	Het
Olfr178	C	T	16: 58,889,758	S154N	possibly damaging	Het
Olfr178	T	A	16: 58,889,759	S154C	probably damaging	Het
Olfr851	T	G	9: 19,496,806	Y19*	probably null	Het
Olfr92	G	A	17: 37,111,508	T158I	probably benign	Het
Otof	T	C	5: 30,388,239	D539G	probably damaging	Het
Pabpc4	T	C	4: 123,294,743	Y382H	possibly damaging	Het
Rag1	T	C	2: 101,642,221	T859A	probably damaging	Het
Ralbp1	C	T	17: 65,852,756	R504H	possibly damaging	Het
Sdk2	A	G	11: 113,780,929	F2131S	probably damaging	Het
Sik1	A	T	17: 31,854,206		probably null	Het
Sis	A	G	3: 72,891,426	I1763T	possibly damaging	Het
Slc39a6	A	G	18: 24,599,319	I304T	possibly damaging	Het
Slc5a12	A	G	2: 110,624,194	S367G	probably benign	Het
Smchd1	A	T	17: 71,436,743	W476R	probably damaging	Het
Spag17	T	C	3: 100,013,235	Y429H	possibly damaging	Het
Stt3a	G	A	9: 36,741,727	S553F	possibly damaging	Het
Sult2a1	C	T	7: 13,801,487	V214I	possibly damaging	Het
Supt6	T	C	11: 78,232,830	E38G	possibly damaging	Het
Tenm4	G	A	7: 96,837,295	G990R	possibly damaging	Het
Thop1	T	C	10: 81,075,661		probably null	Het
Thumpd2	C	A	17: 81,065,030	D11Y	possibly damaging	Het
Tmf1	T	G	6: 97,168,849	I574L	probably damaging	Het
Tnfaip3	A	G	10: 19,003,751	V623A	probably benign	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ush2a	T	G	1: 188,911,237	Y4265*	probably null	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Vmn2r12	A	T	5: 109,092,905	L114Q	probably damaging	Het
Vmn2r98	A	T	17: 19,065,801	Y187F	probably benign	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1525:Ice1	UTSW	13	70605410	missense	probably benign	0.01
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1603:Ice1	UTSW	13	70603353	missense	probably benign	0.01
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2293:Ice1	UTSW	13	70614957	missense	probably damaging	1.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3730:Ice1	UTSW	13	70603240	missense	probably damaging	1.00
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4499:Ice1	UTSW	13	70609027	missense	possibly damaging	0.87
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5078:Ice1	UTSW	13	70604850	missense	probably benign
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6253:Ice1	UTSW	13	70603164	missense	probably damaging	1.00
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6917:Ice1	UTSW	13	70594894	missense	probably damaging	1.00
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7648:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8474:Ice1	UTSW	13	70604447	missense	probably benign	0.42
R8751:Ice1	UTSW	13	70602891	missense	probably damaging	1.00
R8887:Ice1	UTSW	13	70602931	missense	probably damaging	1.00
R8911:Ice1	UTSW	13	70592668	missense
R8954:Ice1	UTSW	13	70610578	missense	probably damaging	1.00
R9345:Ice1	UTSW	13	70592639	missense
R9438:Ice1	UTSW	13	70606315	missense	probably benign	0.04
R9452:Ice1	UTSW	13	70596343	missense	probably damaging	1.00
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTGTCTGTGATGACCTTGG -3'
(R):5'- TAGCATCTGGATCCGTTCTCAG -3'

Sequencing Primer
(F):5'- ATGACCTTGGAGGCGTGGC -3'
(R):5'- GGATCCGTTCTCAGATATATGACCAG -3'

Posted On

2018-09-12