Incidental Mutation 'R6853:Ice1'
ID535105
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Nameinteractor of little elongation complex ELL subunit 1
SynonymsBC018507
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R6853 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location70551707-70637634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70603302 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 1555 (E1555A)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043493
AA Change: E1555A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: E1555A

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik G T 15: 12,817,945 D138E probably benign Het
Atp13a5 A G 16: 29,321,662 S359P possibly damaging Het
Bcam T C 7: 19,760,406 D355G probably damaging Het
Bmp8a C A 4: 123,342,683 W9L unknown Het
Cacul1 A T 19: 60,529,466 Y334* probably null Het
Ccdc178 A T 18: 22,109,876 N227K probably benign Het
Ceacam2 T C 7: 25,518,136 N318S possibly damaging Het
Cntrl T A 2: 35,129,821 S553R possibly damaging Het
Ctsa T A 2: 164,837,364 M331K probably benign Het
Cyp2c38 T A 19: 39,438,304 Q184H probably benign Het
Cyp2c70 C T 19: 40,183,920 E93K possibly damaging Het
D430041D05Rik C T 2: 104,241,155 V1267M probably damaging Het
Ddias C T 7: 92,859,565 A381T possibly damaging Het
Dnhd1 G A 7: 105,703,728 C2696Y probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Farp2 T C 1: 93,570,016 F256S probably damaging Het
Fga A G 3: 83,030,912 Y198C probably damaging Het
Gabpa T A 16: 84,860,499 C421S probably damaging Het
Gm21798 A T 15: 64,817,865 probably benign Het
Gm21798 A T 15: 64,817,867 probably benign Het
Gm7145 A C 1: 117,986,144 N252T possibly damaging Het
H2-Q6 T C 17: 35,428,359 *327R probably null Het
H6pd T C 4: 149,982,462 D489G probably benign Het
Htra2 A G 6: 83,053,831 probably benign Het
Inpp5d T A 1: 87,681,680 probably null Het
Itih2 T C 2: 10,115,266 D320G probably damaging Het
Kif1a T G 1: 93,039,802 H1129P possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
L3mbtl4 G A 17: 68,777,920 D609N probably damaging Het
Lgals9 A T 11: 78,966,006 D248E probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Msh3 A G 13: 92,312,572 probably null Het
Mtus2 A G 5: 148,107,011 K803R probably damaging Het
Oas1a T A 5: 120,907,428 I17L possibly damaging Het
Olfr1480 T A 19: 13,529,931 I130K possibly damaging Het
Olfr178 C T 16: 58,889,758 S154N possibly damaging Het
Olfr178 T A 16: 58,889,759 S154C probably damaging Het
Olfr851 T G 9: 19,496,806 Y19* probably null Het
Olfr92 G A 17: 37,111,508 T158I probably benign Het
Otof T C 5: 30,388,239 D539G probably damaging Het
Pabpc4 T C 4: 123,294,743 Y382H possibly damaging Het
Rag1 T C 2: 101,642,221 T859A probably damaging Het
Ralbp1 C T 17: 65,852,756 R504H possibly damaging Het
Sdk2 A G 11: 113,780,929 F2131S probably damaging Het
Sik1 A T 17: 31,854,206 probably null Het
Sis A G 3: 72,891,426 I1763T possibly damaging Het
Slc39a6 A G 18: 24,599,319 I304T possibly damaging Het
Slc5a12 A G 2: 110,624,194 S367G probably benign Het
Smchd1 A T 17: 71,436,743 W476R probably damaging Het
Spag17 T C 3: 100,013,235 Y429H possibly damaging Het
Stt3a G A 9: 36,741,727 S553F possibly damaging Het
Sult2a1 C T 7: 13,801,487 V214I possibly damaging Het
Supt6 T C 11: 78,232,830 E38G possibly damaging Het
Tenm4 G A 7: 96,837,295 G990R possibly damaging Het
Thop1 T C 10: 81,075,661 probably null Het
Thumpd2 C A 17: 81,065,030 D11Y possibly damaging Het
Tmf1 T G 6: 97,168,849 I574L probably damaging Het
Tnfaip3 A G 10: 19,003,751 V623A probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ush2a T G 1: 188,911,237 Y4265* probably null Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r12 A T 5: 109,092,905 L114Q probably damaging Het
Vmn2r98 A T 17: 19,065,801 Y187F probably benign Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 intron probably null
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGTCTGTGATGACCTTGG -3'
(R):5'- TAGCATCTGGATCCGTTCTCAG -3'

Sequencing Primer
(F):5'- ATGACCTTGGAGGCGTGGC -3'
(R):5'- GGATCCGTTCTCAGATATATGACCAG -3'
Posted On2018-09-12