Incidental Mutation 'R6853:Ice1'
ID 535105
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 044956-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R6853 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 70736808-70785958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 70751421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 1555 (E1555A)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect possibly damaging
Transcript: ENSMUST00000043493
AA Change: E1555A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: E1555A

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik G T 15: 12,818,031 (GRCm39) D138E probably benign Het
Atp13a5 A G 16: 29,140,480 (GRCm39) S359P possibly damaging Het
Bcam T C 7: 19,494,331 (GRCm39) D355G probably damaging Het
Bmp8a C A 4: 123,236,476 (GRCm39) W9L unknown Het
Cacul1 A T 19: 60,517,904 (GRCm39) Y334* probably null Het
Ccdc178 A T 18: 22,242,933 (GRCm39) N227K probably benign Het
Ceacam2 T C 7: 25,217,561 (GRCm39) N318S possibly damaging Het
Cntrl T A 2: 35,019,833 (GRCm39) S553R possibly damaging Het
Ctsa T A 2: 164,679,284 (GRCm39) M331K probably benign Het
Cyp2c38 T A 19: 39,426,748 (GRCm39) Q184H probably benign Het
Cyp2c70 C T 19: 40,172,364 (GRCm39) E93K possibly damaging Het
D430041D05Rik C T 2: 104,071,500 (GRCm39) V1267M probably damaging Het
Ddias C T 7: 92,508,773 (GRCm39) A381T possibly damaging Het
Dnhd1 G A 7: 105,352,935 (GRCm39) C2696Y probably benign Het
Efr3a G A 15: 65,701,679 (GRCm39) V198I probably benign Het
Farp2 T C 1: 93,497,738 (GRCm39) F256S probably damaging Het
Fga A G 3: 82,938,219 (GRCm39) Y198C probably damaging Het
Gabpa T A 16: 84,657,387 (GRCm39) C421S probably damaging Het
Gm21798 A T 15: 64,689,714 (GRCm39) probably benign Het
Gm21798 A T 15: 64,689,716 (GRCm39) probably benign Het
Gm7145 A C 1: 117,913,874 (GRCm39) N252T possibly damaging Het
H2-Q6 T C 17: 35,647,335 (GRCm39) *327R probably null Het
H6pd T C 4: 150,066,919 (GRCm39) D489G probably benign Het
Htra2 A G 6: 83,030,812 (GRCm39) probably benign Het
Inpp5d T A 1: 87,609,402 (GRCm39) probably null Het
Itih2 T C 2: 10,120,077 (GRCm39) D320G probably damaging Het
Kif1a T G 1: 92,967,524 (GRCm39) H1129P possibly damaging Het
Kmt2a G A 9: 44,729,704 (GRCm39) probably benign Het
L3mbtl4 G A 17: 69,084,915 (GRCm39) D609N probably damaging Het
Lgals9 A T 11: 78,856,832 (GRCm39) D248E probably benign Het
Lhx9 ACC ACCC 1: 138,769,544 (GRCm39) probably null Het
Msh3 A G 13: 92,449,080 (GRCm39) probably null Het
Mtus2 A G 5: 148,043,821 (GRCm39) K803R probably damaging Het
Oas1a T A 5: 121,045,491 (GRCm39) I17L possibly damaging Het
Or2h2c G A 17: 37,422,400 (GRCm39) T158I probably benign Het
Or5b121 T A 19: 13,507,295 (GRCm39) I130K possibly damaging Het
Or5k15 C T 16: 58,710,121 (GRCm39) S154N possibly damaging Het
Or5k15 T A 16: 58,710,122 (GRCm39) S154C probably damaging Het
Or7g32 T G 9: 19,408,102 (GRCm39) Y19* probably null Het
Otof T C 5: 30,545,583 (GRCm39) D539G probably damaging Het
Pabpc4 T C 4: 123,188,536 (GRCm39) Y382H possibly damaging Het
Rag1 T C 2: 101,472,566 (GRCm39) T859A probably damaging Het
Ralbp1 C T 17: 66,159,751 (GRCm39) R504H possibly damaging Het
Sdk2 A G 11: 113,671,755 (GRCm39) F2131S probably damaging Het
Sik1 A T 17: 32,073,180 (GRCm39) probably null Het
Sis A G 3: 72,798,759 (GRCm39) I1763T possibly damaging Het
Slc39a6 A G 18: 24,732,376 (GRCm39) I304T possibly damaging Het
Slc5a12 A G 2: 110,454,539 (GRCm39) S367G probably benign Het
Smchd1 A T 17: 71,743,738 (GRCm39) W476R probably damaging Het
Spag17 T C 3: 99,920,551 (GRCm39) Y429H possibly damaging Het
Stt3a G A 9: 36,653,023 (GRCm39) S553F possibly damaging Het
Sult2a1 C T 7: 13,535,412 (GRCm39) V214I possibly damaging Het
Supt6 T C 11: 78,123,656 (GRCm39) E38G possibly damaging Het
Tenm4 G A 7: 96,486,502 (GRCm39) G990R possibly damaging Het
Thop1 T C 10: 80,911,495 (GRCm39) probably null Het
Thumpd2 C A 17: 81,372,459 (GRCm39) D11Y possibly damaging Het
Tmf1 T G 6: 97,145,810 (GRCm39) I574L probably damaging Het
Tnfaip3 A G 10: 18,879,499 (GRCm39) V623A probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Ush2a T G 1: 188,643,434 (GRCm39) Y4265* probably null Het
Vamp5 G A 6: 72,357,424 (GRCm39) probably benign Het
Vmn2r12 A T 5: 109,240,771 (GRCm39) L114Q probably damaging Het
Vmn2r98 A T 17: 19,286,063 (GRCm39) Y187F probably benign Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70,750,408 (GRCm39) missense probably damaging 1.00
IGL01155:Ice1 APN 13 70,752,201 (GRCm39) missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70,753,023 (GRCm39) missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70,772,065 (GRCm39) missense probably damaging 1.00
IGL02423:Ice1 APN 13 70,740,718 (GRCm39) missense probably damaging 1.00
IGL02583:Ice1 APN 13 70,753,854 (GRCm39) missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70,757,278 (GRCm39) missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70,772,593 (GRCm39) splice site probably benign
IGL02929:Ice1 APN 13 70,744,322 (GRCm39) missense probably damaging 1.00
IGL03343:Ice1 APN 13 70,751,048 (GRCm39) missense probably damaging 1.00
IGL03384:Ice1 APN 13 70,751,368 (GRCm39) missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70,772,040 (GRCm39) critical splice donor site probably null
R0078:Ice1 UTSW 13 70,751,467 (GRCm39) missense probably damaging 0.98
R0081:Ice1 UTSW 13 70,767,163 (GRCm39) nonsense probably null
R0281:Ice1 UTSW 13 70,752,166 (GRCm39) missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70,749,310 (GRCm39) missense probably benign 0.08
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0974:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R1033:Ice1 UTSW 13 70,754,713 (GRCm39) missense probably damaging 0.96
R1371:Ice1 UTSW 13 70,744,340 (GRCm39) missense probably damaging 1.00
R1525:Ice1 UTSW 13 70,753,529 (GRCm39) missense probably benign 0.01
R1539:Ice1 UTSW 13 70,754,023 (GRCm39) missense probably damaging 1.00
R1596:Ice1 UTSW 13 70,753,014 (GRCm39) missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70,751,472 (GRCm39) missense probably benign 0.01
R1680:Ice1 UTSW 13 70,753,567 (GRCm39) missense probably benign 0.00
R1737:Ice1 UTSW 13 70,754,444 (GRCm39) missense probably damaging 0.99
R1766:Ice1 UTSW 13 70,752,561 (GRCm39) missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70,752,672 (GRCm39) missense probably damaging 1.00
R1834:Ice1 UTSW 13 70,763,457 (GRCm39) missense probably damaging 0.99
R1840:Ice1 UTSW 13 70,754,337 (GRCm39) missense probably benign 0.00
R1898:Ice1 UTSW 13 70,750,426 (GRCm39) missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70,753,202 (GRCm39) missense probably benign 0.18
R2000:Ice1 UTSW 13 70,750,546 (GRCm39) missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70,753,741 (GRCm39) missense probably benign 0.00
R2293:Ice1 UTSW 13 70,763,076 (GRCm39) missense probably damaging 1.00
R2377:Ice1 UTSW 13 70,750,899 (GRCm39) missense probably damaging 1.00
R2909:Ice1 UTSW 13 70,744,292 (GRCm39) missense probably damaging 1.00
R2965:Ice1 UTSW 13 70,750,697 (GRCm39) missense probably benign 0.31
R3730:Ice1 UTSW 13 70,751,359 (GRCm39) missense probably damaging 1.00
R3886:Ice1 UTSW 13 70,753,489 (GRCm39) missense probably benign 0.00
R3914:Ice1 UTSW 13 70,754,203 (GRCm39) missense probably benign 0.30
R4051:Ice1 UTSW 13 70,751,646 (GRCm39) missense probably damaging 1.00
R4321:Ice1 UTSW 13 70,751,229 (GRCm39) missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70,757,146 (GRCm39) missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70,754,503 (GRCm39) missense probably damaging 1.00
R5078:Ice1 UTSW 13 70,752,969 (GRCm39) missense probably benign
R5431:Ice1 UTSW 13 70,740,769 (GRCm39) missense probably damaging 1.00
R5722:Ice1 UTSW 13 70,763,219 (GRCm39) missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70,754,620 (GRCm39) missense probably benign 0.04
R5914:Ice1 UTSW 13 70,754,496 (GRCm39) missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70,754,850 (GRCm39) missense probably benign
R6253:Ice1 UTSW 13 70,751,283 (GRCm39) missense probably damaging 1.00
R6274:Ice1 UTSW 13 70,742,958 (GRCm39) missense probably damaging 0.97
R6518:Ice1 UTSW 13 70,754,428 (GRCm39) missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70,751,592 (GRCm39) missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70,763,382 (GRCm39) splice site probably null
R6917:Ice1 UTSW 13 70,743,013 (GRCm39) missense probably damaging 1.00
R7032:Ice1 UTSW 13 70,744,283 (GRCm39) missense probably damaging 0.99
R7176:Ice1 UTSW 13 70,772,525 (GRCm39) critical splice donor site probably null
R7352:Ice1 UTSW 13 70,754,221 (GRCm39) nonsense probably null
R7445:Ice1 UTSW 13 70,744,286 (GRCm39) missense
R7646:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70,753,602 (GRCm39) missense probably damaging 1.00
R7650:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7812:Ice1 UTSW 13 70,751,124 (GRCm39) missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70,751,851 (GRCm39) missense probably damaging 1.00
R8129:Ice1 UTSW 13 70,754,320 (GRCm39) missense probably benign 0.02
R8283:Ice1 UTSW 13 70,752,549 (GRCm39) missense probably damaging 0.97
R8303:Ice1 UTSW 13 70,754,526 (GRCm39) missense probably benign 0.04
R8444:Ice1 UTSW 13 70,752,495 (GRCm39) missense probably damaging 1.00
R8474:Ice1 UTSW 13 70,752,566 (GRCm39) missense probably benign 0.42
R8751:Ice1 UTSW 13 70,751,010 (GRCm39) missense probably damaging 1.00
R8887:Ice1 UTSW 13 70,751,050 (GRCm39) missense probably damaging 1.00
R8911:Ice1 UTSW 13 70,740,787 (GRCm39) missense
R8954:Ice1 UTSW 13 70,758,697 (GRCm39) missense probably damaging 1.00
R9345:Ice1 UTSW 13 70,740,758 (GRCm39) missense
R9438:Ice1 UTSW 13 70,754,434 (GRCm39) missense probably benign 0.04
R9452:Ice1 UTSW 13 70,744,462 (GRCm39) missense probably damaging 1.00
X0026:Ice1 UTSW 13 70,740,721 (GRCm39) missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70,753,320 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGTCTGTGATGACCTTGG -3'
(R):5'- TAGCATCTGGATCCGTTCTCAG -3'

Sequencing Primer
(F):5'- ATGACCTTGGAGGCGTGGC -3'
(R):5'- GGATCCGTTCTCAGATATATGACCAG -3'
Posted On 2018-09-12