Incidental Mutation 'R8283:Ice1'
ID 638334
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock # R8283 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 70551707-70637634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70604430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1179 (E1179G)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493]
AlphaFold E9Q286
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: E1179G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: E1179G

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,806,086 P65S probably damaging Het
Adcy3 A T 12: 4,200,935 R565W probably damaging Het
Arl14 A T 3: 69,222,535 N5I probably benign Het
Arl6ip6 A G 2: 53,192,238 E39G possibly damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
Boc A T 16: 44,520,437 L50Q noncoding transcript Het
Calml3 A G 13: 3,804,097 V36A probably damaging Het
Ccdc183 G A 2: 25,612,148 A238V probably damaging Het
Ccndbp1 A G 2: 121,008,584 probably benign Het
Ccr9 A G 9: 123,779,631 Y126C probably damaging Het
Cdhr1 T C 14: 37,082,780 N491S probably benign Het
Celsr2 C T 3: 108,396,455 G2429D probably damaging Het
Cts6 T C 13: 61,201,643 T84A probably damaging Het
Dcpp2 T C 17: 23,899,410 probably null Het
Drosha A G 15: 12,890,501 I945V possibly damaging Het
Dsg1b A G 18: 20,391,906 Q133R probably benign Het
Enpp1 T A 10: 24,674,656 E174D probably benign Het
Esrrb A G 12: 86,421,958 H15R probably benign Het
Fbxl12 T C 9: 20,638,721 T213A probably benign Het
Fnbp4 C A 2: 90,746,771 T149K probably damaging Het
Foxj1 A T 11: 116,334,067 F158Y probably benign Het
Frrs1 A G 3: 116,878,303 T17A probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Hnrnpl T C 7: 28,814,272 V220A Het
Iars2 T A 1: 185,288,091 R949* probably null Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mcmdc2 A C 1: 9,934,038 K581T possibly damaging Het
Men1 A T 19: 6,336,818 D186V probably damaging Het
Morc2b T G 17: 33,136,701 N699T probably benign Het
Mrgpra2b A G 7: 47,464,717 L89P probably damaging Het
Naip1 C T 13: 100,427,187 G490E probably damaging Het
Ntm T C 9: 29,012,212 Y224C probably damaging Het
Nup88 A T 11: 70,958,340 D262E probably benign Het
Olfr1113 T C 2: 87,213,339 V149A probably benign Het
Olfr630 T A 7: 103,754,812 I258L possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Oscp1 A G 4: 126,086,600 M293V probably benign Het
Pcdhgc3 C A 18: 37,807,641 A365D probably damaging Het
Pcyt2 A T 11: 120,610,722 F388I probably benign Het
Pgm2l1 C G 7: 100,253,253 A136G probably benign Het
Phf14 T G 6: 11,987,637 D638E probably benign Het
Pnpla7 A G 2: 25,050,923 K1096E probably damaging Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Rnf187 T A 11: 58,938,415 R124W probably damaging Het
RP24-77E13.10 T C 7: 7,241,902 Y11C possibly damaging Het
Sema3a T C 5: 13,400,063 Y36H probably damaging Het
Setd7 T G 3: 51,521,375 S345R probably benign Het
Sgms1 T C 19: 32,159,635 D177G probably damaging Het
Snx19 T C 9: 30,463,226 L927S possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sorl1 T C 9: 42,030,998 D977G probably damaging Het
Sptan1 C T 2: 29,980,200 R121W probably damaging Het
Srgap2 T C 1: 131,364,033 D152G probably damaging Het
Suclg2 T A 6: 95,497,719 probably null Het
Tacc2 T C 7: 130,625,304 S1240P probably benign Het
Tbc1d12 C T 19: 38,836,909 A68V probably benign Het
Tex14 G A 11: 87,474,415 D62N probably damaging Het
Thyn1 C T 9: 27,006,859 T181I probably benign Het
Trio T A 15: 27,756,542 H2056L possibly damaging Het
Ubn2 T A 6: 38,498,728 L1207Q probably damaging Het
Usp17lb T C 7: 104,840,806 S305G probably damaging Het
Vmn2r101 T A 17: 19,611,991 Y750N probably damaging Het
Wif1 G A 10: 121,096,047 S292N probably benign Het
Xpo6 T G 7: 126,128,249 Q528H possibly damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
R8444:Ice1 UTSW 13 70604376 missense probably damaging 1.00
R8474:Ice1 UTSW 13 70604447 missense probably benign 0.42
R8751:Ice1 UTSW 13 70602891 missense probably damaging 1.00
R8887:Ice1 UTSW 13 70602931 missense probably damaging 1.00
R8911:Ice1 UTSW 13 70592668 missense
R8954:Ice1 UTSW 13 70610578 missense probably damaging 1.00
R9345:Ice1 UTSW 13 70592639 missense
R9438:Ice1 UTSW 13 70606315 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCCACAGGGTTTGTATCG -3'
(R):5'- ACCCCTCAGATGTAGGTGATCTG -3'

Sequencing Primer
(F):5'- TTCCCCGGTCTTGGTGAGAAC -3'
(R):5'- CAGATGTAGGTGATCTGACCTCC -3'
Posted On 2020-07-28