Incidental Mutation 'R4729:Ice1'
ID 358707
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 041603-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock # R4729 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 70551707-70637634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70606384 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 528 (R528G)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: R528G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: R528G

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,849,323 L220H unknown Het
Amt T A 9: 108,300,652 L272Q probably damaging Het
Ank2 G C 3: 126,976,896 Y894* probably null Het
Ankzf1 T A 1: 75,194,264 F105I probably damaging Het
Aox4 C A 1: 58,259,077 Y1067* probably null Het
BC034090 T A 1: 155,225,090 Q476L probably damaging Het
Bhmt G T 13: 93,627,363 R57S probably damaging Het
Cacna1c A T 6: 118,656,175 F964L probably damaging Het
Celsr3 A C 9: 108,847,652 S396R probably benign Het
Cpne4 C A 9: 104,922,556 Q191K probably damaging Het
Csnk1g2 T C 10: 80,639,204 Y352H probably benign Het
D630003M21Rik A G 2: 158,216,703 S426P probably damaging Het
Dido1 G T 2: 180,687,650 N326K probably benign Het
E2f2 T A 4: 136,184,449 I257N probably damaging Het
Elfn1 T G 5: 139,973,658 F806V probably damaging Het
Eml6 T A 11: 29,833,204 Y559F probably damaging Het
Erich6 A G 3: 58,636,059 probably null Het
Fam45a T A 19: 60,834,871 F315I probably benign Het
Fam78a T C 2: 32,082,605 N101S probably damaging Het
Fam83h A G 15: 76,002,336 S1051P probably benign Het
Galns C T 8: 122,603,456 G112D probably damaging Het
Gm7075 A T 10: 63,421,465 V92E probably damaging Het
Gm9923 A G 10: 72,309,694 K125R probably damaging Het
Hectd3 G A 4: 116,997,218 V326M probably damaging Het
Iars2 A G 1: 185,316,051 S495P possibly damaging Het
Igkv12-38 T A 6: 69,943,384 Y50F possibly damaging Het
Inpp5j T C 11: 3,495,025 S883G probably damaging Het
Irf8 T C 8: 120,753,439 S139P probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kcnq4 G T 4: 120,713,074 D357E possibly damaging Het
Klhl1 A G 14: 96,280,148 L364P probably damaging Het
Krt7 A G 15: 101,420,558 I309V probably benign Het
Krt76 G T 15: 101,889,081 A281D probably damaging Het
Lancl2 T C 6: 57,737,712 F430L probably damaging Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc26 A T 2: 25,290,064 T26S probably benign Het
Lrrk1 T A 7: 66,262,293 M1840L probably benign Het
Lyst G A 13: 13,637,901 C966Y probably damaging Het
Mad1l1 T A 5: 140,261,511 S354C possibly damaging Het
Mbtps1 C T 8: 119,525,420 G577D probably damaging Het
Mycbp2 C T 14: 103,188,591 R2366H probably damaging Het
Myo18a T G 11: 77,777,685 probably null Het
Naip5 G A 13: 100,222,131 R866C possibly damaging Het
Nav2 T A 7: 49,452,819 V455E probably benign Het
Neb A G 2: 52,263,662 I2417T possibly damaging Het
Nme5 C T 18: 34,569,837 A133T probably benign Het
Nradd T C 9: 110,621,911 D51G possibly damaging Het
Pard3b A G 1: 62,211,684 R591G probably damaging Het
Pcbp4 T C 9: 106,460,730 F73S probably damaging Het
Pcdhb11 C T 18: 37,422,366 Q250* probably null Het
Pde1c T A 6: 56,072,209 K766N probably damaging Het
Phf21b G A 15: 84,854,741 Q40* probably null Het
Prr14 A G 7: 127,474,696 D244G probably benign Het
Rab11fip5 C T 6: 85,374,267 A88T probably damaging Het
Rad54l2 A T 9: 106,716,118 S428T probably benign Het
Rdh9 A G 10: 127,776,752 I90V probably benign Het
Rhag G T 17: 40,828,401 G76C probably damaging Het
Riok3 T A 18: 12,128,927 V6E possibly damaging Het
Scn10a A G 9: 119,671,526 I229T probably damaging Het
Slco1a1 G T 6: 141,908,969 T652K probably benign Het
Slit1 T A 19: 41,647,020 I345F probably damaging Het
Snrnp200 A T 2: 127,232,937 I1477F probably damaging Het
Snx31 G A 15: 36,523,552 T328I possibly damaging Het
Strn A G 17: 78,657,961 F634S probably damaging Het
Tmem101 C T 11: 102,156,329 G6R probably benign Het
Tmem199 C G 11: 78,508,680 G131R probably benign Het
Trim66 A G 7: 109,456,060 probably null Het
Ttn G T 2: 76,851,585 probably benign Het
Upk3bl T C 5: 136,057,393 L61P probably benign Het
Vmn2r108 A G 17: 20,472,370 Y75H probably damaging Het
Vmn2r91 T A 17: 18,107,644 I500K probably damaging Het
Vps18 C T 2: 119,293,791 R400C probably damaging Het
Zeb1 C T 18: 5,767,286 P599L probably damaging Het
Zfhx4 G T 3: 5,399,497 A1572S probably damaging Het
Zfp677 T A 17: 21,397,418 C246S possibly damaging Het
Zfp719 T A 7: 43,590,410 I474N probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
R8444:Ice1 UTSW 13 70604376 missense probably damaging 1.00
R8474:Ice1 UTSW 13 70604447 missense probably benign 0.42
R8751:Ice1 UTSW 13 70602891 missense probably damaging 1.00
R8887:Ice1 UTSW 13 70602931 missense probably damaging 1.00
R8911:Ice1 UTSW 13 70592668 missense
R8954:Ice1 UTSW 13 70610578 missense probably damaging 1.00
R9345:Ice1 UTSW 13 70592639 missense
R9438:Ice1 UTSW 13 70606315 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGCCTGACTGGGGAGTG -3'
(R):5'- CATCTGAATTTGTGAGGGACAGAG -3'

Sequencing Primer
(F):5'- AGTGGACTCCCGCACATCTC -3'
(R):5'- TTTGTGAGGGACAGAGGAGAC -3'
Posted On 2015-11-11