Mutagenetix > Incidental Mutations

Incidental Mutation 'R7648:Ice1'

590656

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R7648 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70589797 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2177 (V2177A)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637]

AlphaFold

E9Q286

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043493
AA Change: V2177A

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: V2177A

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220637

Predicted Effect

probably benign
Transcript: ENSMUST00000222274

Predicted Effect

probably benign
Transcript: ENSMUST00000223102

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	C	7: 41,612,462	V46A	possibly damaging	Het
Asb13	C	A	13: 3,649,332	N177K	probably damaging	Het
Asprv1	A	G	6: 86,628,870	T233A	probably damaging	Het
Atad2b	T	A	12: 5,027,182		probably null	Het
Atxn2	G	T	5: 121,796,377	V880F	probably damaging	Het
Car14	T	C	3: 95,898,195	N322S	probably benign	Het
Cdc42bpb	T	C	12: 111,377,153	E40G	probably damaging	Het
Ceacam16	G	T	7: 19,852,278	A103E	unknown	Het
Cnnm2	A	G	19: 46,877,900	D829G	probably damaging	Het
Cpt1b	C	T	15: 89,421,367	A382T	probably damaging	Het
Crygc	A	G	1: 65,073,325	F30S	probably damaging	Het
Cstf2t	A	G	19: 31,083,592	Q176R	possibly damaging	Het
Ctif	A	T	18: 75,637,142	H57Q	probably benign	Het
Cyp2c40	A	G	19: 39,803,845	*195Q	probably null	Het
Cyp2j8	T	A	4: 96,499,603	D207V	probably damaging	Het
Ddx49	A	G	8: 70,297,955	V123A	possibly damaging	Het
E4f1	A	T	17: 24,445,448	I456K	probably benign	Het
Eif4b	T	C	15: 102,089,000	S317P	unknown	Het
Enam	A	T	5: 88,504,157	Q1175L	possibly damaging	Het
Eppk1	T	C	15: 76,110,671	Y670C	probably benign	Het
Fam163b	G	T	2: 27,112,740	Q82K	probably benign	Het
Fam193a	A	T	5: 34,431,182	K358N	probably damaging	Het
Gls	C	A	1: 52,196,780	R392L	probably damaging	Het
Gm12569	G	A	11: 51,234,786	E179K	possibly damaging	Het
Gramd1c	A	G	16: 43,989,869	V247A	probably damaging	Het
Gucy1a1	C	T	3: 82,108,707	E325K	possibly damaging	Het
Hectd4	T	C	5: 121,254,371	C233R	possibly damaging	Het
Kif28	A	G	1: 179,709,424	V498A	possibly damaging	Het
Klhdc7a	T	C	4: 139,965,939	S566G	possibly damaging	Het
Mlph	G	A	1: 90,933,526		probably null	Het
Mndal	T	A	1: 173,857,395	Y536F	probably benign	Het
Mrgpra2a	A	T	7: 47,426,663	C282*	probably null	Het
Msh3	A	T	13: 92,274,028	I684N	probably damaging	Het
Mylk	G	C	16: 34,879,524	S419T	probably benign	Het
Nfxl1	T	C	5: 72,523,536	K747R	probably benign	Het
Nup98	T	G	7: 102,124,197	H1641P	possibly damaging	Het
Olfr881	A	C	9: 37,992,560	T18P	probably damaging	Het
Pcm1	A	G	8: 41,275,699	N570D	probably damaging	Het
Plekhh1	T	A	12: 79,055,131	V325E	probably benign	Het
Rabl3	A	T	16: 37,563,758	I176F	probably damaging	Het
Relb	T	C	7: 19,619,842	E37G	possibly damaging	Het
Slc4a7	G	A	14: 14,773,348	E773K	probably benign	Het
Tars2	G	A	3: 95,750,982	T177I	probably benign	Het
Tenm2	T	A	11: 36,106,736	N842I	probably damaging	Het
Tmem175	A	G	5: 108,644,566	E236G	possibly damaging	Het
Trank1	A	G	9: 111,391,685	T2497A	probably benign	Het
Trf	A	G	9: 103,227,969	V48A	probably benign	Het
Ttc28	A	G	5: 111,183,392	K493E	possibly damaging	Het
Unc50	T	C	1: 37,431,321	S9P	probably benign	Het
Uso1	T	A	5: 92,194,002		probably null	Het
Usp49	A	T	17: 47,674,828	N487I	possibly damaging	Het
Xab2	T	C	8: 3,610,638	D768G	probably benign	Het
Xcr1	T	C	9: 123,856,592	E35G	possibly damaging	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1525:Ice1	UTSW	13	70605410	missense	probably benign	0.01
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1603:Ice1	UTSW	13	70603353	missense	probably benign	0.01
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2293:Ice1	UTSW	13	70614957	missense	probably damaging	1.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3730:Ice1	UTSW	13	70603240	missense	probably damaging	1.00
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4499:Ice1	UTSW	13	70609027	missense	possibly damaging	0.87
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5078:Ice1	UTSW	13	70604850	missense	probably benign
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6253:Ice1	UTSW	13	70603164	missense	probably damaging	1.00
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6853:Ice1	UTSW	13	70603302	missense	possibly damaging	0.92
R6917:Ice1	UTSW	13	70594894	missense	probably damaging	1.00
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8474:Ice1	UTSW	13	70604447	missense	probably benign	0.42
R8751:Ice1	UTSW	13	70602891	missense	probably damaging	1.00
R8887:Ice1	UTSW	13	70602931	missense	probably damaging	1.00
R8911:Ice1	UTSW	13	70592668	missense
R8954:Ice1	UTSW	13	70610578	missense	probably damaging	1.00
R9345:Ice1	UTSW	13	70592639	missense
R9438:Ice1	UTSW	13	70606315	missense	probably benign	0.04
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGTCTCCTTTGCTTGTACAG -3'
(R):5'- GGACAGGGAGCTCTTAGTTTTC -3'

Sequencing Primer
(F):5'- TTGTACAGCCAGCCGAGC -3'
(R):5'- CATTTGTAGACAGGTCTTGAATGAAC -3'

Posted On

2019-10-24