Incidental Mutation 'R7183:Phlpp2'
ID 559112
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene Name PH domain and leucine rich repeat protein phosphatase 2
Synonyms C130044A18Rik, Phlppl
MMRRC Submission 045235-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R7183 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 110595174-110671303 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 110666585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 1038 (P1038Q)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
AlphaFold Q8BXA7
Predicted Effect probably damaging
Transcript: ENSMUST00000034175
AA Change: P1003Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: P1003Q

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179721
AA Change: P1038Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: P1038Q

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,215,706 (GRCm39) M816L possibly damaging Het
Ahnak T C 19: 8,995,032 (GRCm39) F5439L probably damaging Het
Apba2 G A 7: 64,383,293 (GRCm39) D369N probably benign Het
Arhgap32 A G 9: 32,097,679 (GRCm39) N228D probably benign Het
Arhgap33 T A 7: 30,225,296 (GRCm39) probably null Het
Cacna1g C T 11: 94,330,563 (GRCm39) C984Y probably benign Het
Cadm2 C A 16: 66,679,720 (GRCm39) G47* probably null Het
Ccdc125 A G 13: 100,826,866 (GRCm39) D241G possibly damaging Het
Ccdc39 T G 3: 33,868,620 (GRCm39) E822A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Cdc42bpg A G 19: 6,360,827 (GRCm39) D195G probably damaging Het
Cdkl1 T C 12: 69,795,706 (GRCm39) R275G probably damaging Het
Chst4 T C 8: 110,756,630 (GRCm39) N411S possibly damaging Het
Cir1 A G 2: 73,116,730 (GRCm39) V210A probably damaging Het
Col6a1 A G 10: 76,552,093 (GRCm39) probably null Het
Crmp1 C A 5: 37,446,161 (GRCm39) H606N probably benign Het
Cyp2j8 A T 4: 96,367,418 (GRCm39) N233K probably damaging Het
Dennd1b A T 1: 139,097,990 (GRCm39) Q677L unknown Het
Dnah17 G A 11: 118,020,014 (GRCm39) T11I probably benign Het
Ehd1 A G 19: 6,347,684 (GRCm39) H346R probably benign Het
Eif1ad14 G A 12: 87,886,492 (GRCm39) R46W possibly damaging Het
Emc3 G T 6: 113,508,345 (GRCm39) Y33* probably null Het
Ercc5 A T 1: 44,200,968 (GRCm39) probably null Het
Ercc5 G T 1: 44,200,969 (GRCm39) probably null Het
Fat3 A C 9: 15,834,133 (GRCm39) I4153S possibly damaging Het
Fn3krp T C 11: 121,312,431 (GRCm39) probably null Het
Gmnc C T 16: 26,779,279 (GRCm39) D249N probably benign Het
Gsn C T 2: 35,184,960 (GRCm39) A305V probably benign Het
Haus6 A T 4: 86,501,989 (GRCm39) H627Q possibly damaging Het
Heg1 A G 16: 33,558,920 (GRCm39) probably null Het
Hoxd9 G T 2: 74,528,709 (GRCm39) V104L possibly damaging Het
Igkv10-96 A C 6: 68,609,200 (GRCm39) S32A probably benign Het
Kcnd2 G A 6: 21,216,436 (GRCm39) V47M probably damaging Het
Mab21l3 C T 3: 101,722,469 (GRCm39) V386M probably damaging Het
Masp2 A G 4: 148,696,614 (GRCm39) S404G probably benign Het
Or5b102 A G 19: 13,041,680 (GRCm39) I302V probably benign Het
Or5m12 T A 2: 85,734,486 (GRCm39) Q304L probably benign Het
Or7g20 G T 9: 18,946,628 (GRCm39) D70Y probably damaging Het
P4htm A T 9: 108,459,059 (GRCm39) M291K possibly damaging Het
Pde6c T C 19: 38,121,538 (GRCm39) S49P probably benign Het
Pdzd7 A G 19: 45,025,553 (GRCm39) V314A probably benign Het
Pfkl G A 10: 77,837,916 (GRCm39) R31* probably null Het
Pik3c2b T C 1: 132,994,203 (GRCm39) S56P probably benign Het
Plec A G 15: 76,089,905 (GRCm39) V145A unknown Het
Prg3 G A 2: 84,821,848 (GRCm39) V158I probably benign Het
Prg3 G T 2: 84,823,367 (GRCm39) D181Y probably damaging Het
Rbp3 A G 14: 33,677,161 (GRCm39) T370A probably benign Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Rubcnl T A 14: 75,287,066 (GRCm39) M578K probably damaging Het
Siae G A 9: 37,528,242 (GRCm39) V72M possibly damaging Het
Smchd1 A T 17: 71,660,511 (GRCm39) D1864E probably benign Het
Smox T C 2: 131,362,486 (GRCm39) I255T possibly damaging Het
Spata31e2 G A 1: 26,721,914 (GRCm39) L1089F probably benign Het
Tas2r123 A G 6: 132,824,661 (GRCm39) N186S possibly damaging Het
Thbs2 T A 17: 14,910,378 (GRCm39) I74F possibly damaging Het
Timm44 T C 8: 4,317,311 (GRCm39) D238G probably damaging Het
Tlk2 T C 11: 105,112,185 (GRCm39) probably null Het
Tnc A G 4: 63,931,365 (GRCm39) S782P probably damaging Het
Tpr A T 1: 150,282,302 (GRCm39) K336N probably damaging Het
Uggt2 A T 14: 119,257,049 (GRCm39) probably null Het
Vmn2r101 T A 17: 19,832,440 (GRCm39) I812N probably damaging Het
Vps33a T C 5: 123,673,278 (GRCm39) Q436R probably null Het
Ywhaq T C 12: 21,466,870 (GRCm39) K75E possibly damaging Het
Zfp87 A G 13: 67,665,593 (GRCm39) S290P probably damaging Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 110,652,422 (GRCm39) missense probably benign 0.01
IGL01363:Phlpp2 APN 8 110,663,729 (GRCm39) missense probably benign 0.22
IGL01535:Phlpp2 APN 8 110,660,697 (GRCm39) missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 110,666,491 (GRCm39) missense probably benign
IGL02105:Phlpp2 APN 8 110,631,040 (GRCm39) missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 110,646,731 (GRCm39) missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 110,666,505 (GRCm39) missense probably benign 0.04
IGL02500:Phlpp2 APN 8 110,640,250 (GRCm39) missense probably benign
IGL03356:Phlpp2 APN 8 110,662,249 (GRCm39) missense probably benign 0.00
IGL03366:Phlpp2 APN 8 110,667,467 (GRCm39) missense probably benign 0.44
R0142:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 110,666,567 (GRCm39) missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 110,655,095 (GRCm39) missense probably benign 0.01
R0477:Phlpp2 UTSW 8 110,622,138 (GRCm39) critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 110,603,603 (GRCm39) missense probably benign 0.00
R0605:Phlpp2 UTSW 8 110,659,843 (GRCm39) missense probably benign 0.00
R0655:Phlpp2 UTSW 8 110,622,219 (GRCm39) missense probably benign 0.00
R0833:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 110,603,662 (GRCm39) nonsense probably null
R1417:Phlpp2 UTSW 8 110,667,313 (GRCm39) nonsense probably null
R1602:Phlpp2 UTSW 8 110,660,655 (GRCm39) missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 110,660,587 (GRCm39) splice site probably benign
R1815:Phlpp2 UTSW 8 110,666,855 (GRCm39) missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 110,634,232 (GRCm39) missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 110,666,634 (GRCm39) missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 110,634,245 (GRCm39) missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 110,603,515 (GRCm39) missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 110,667,452 (GRCm39) missense probably benign 0.31
R4739:Phlpp2 UTSW 8 110,667,052 (GRCm39) missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 110,603,642 (GRCm39) missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 110,666,714 (GRCm39) missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 110,640,251 (GRCm39) missense probably benign 0.04
R5074:Phlpp2 UTSW 8 110,652,461 (GRCm39) missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 110,660,667 (GRCm39) missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 110,630,976 (GRCm39) missense probably benign 0.01
R5668:Phlpp2 UTSW 8 110,655,205 (GRCm39) missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 110,661,317 (GRCm39) missense probably benign
R6470:Phlpp2 UTSW 8 110,663,826 (GRCm39) missense probably benign 0.45
R6804:Phlpp2 UTSW 8 110,655,197 (GRCm39) missense probably damaging 1.00
R7012:Phlpp2 UTSW 8 110,603,486 (GRCm39) missense possibly damaging 0.95
R7257:Phlpp2 UTSW 8 110,666,820 (GRCm39) missense probably benign
R7312:Phlpp2 UTSW 8 110,666,785 (GRCm39) missense probably damaging 0.96
R7349:Phlpp2 UTSW 8 110,655,278 (GRCm39) missense probably damaging 0.98
R7801:Phlpp2 UTSW 8 110,652,474 (GRCm39) missense possibly damaging 0.56
R8059:Phlpp2 UTSW 8 110,622,189 (GRCm39) missense probably benign 0.00
R8174:Phlpp2 UTSW 8 110,595,321 (GRCm39) missense unknown
R8242:Phlpp2 UTSW 8 110,666,834 (GRCm39) missense probably benign 0.03
R8488:Phlpp2 UTSW 8 110,640,202 (GRCm39) missense probably benign
R8688:Phlpp2 UTSW 8 110,631,012 (GRCm39) missense probably damaging 1.00
R8843:Phlpp2 UTSW 8 110,652,431 (GRCm39) missense probably benign 0.18
R9154:Phlpp2 UTSW 8 110,666,590 (GRCm39) missense possibly damaging 0.82
R9556:Phlpp2 UTSW 8 110,666,758 (GRCm39) missense probably benign
R9737:Phlpp2 UTSW 8 110,663,714 (GRCm39) missense probably damaging 0.99
R9781:Phlpp2 UTSW 8 110,662,178 (GRCm39) missense possibly damaging 0.95
R9786:Phlpp2 UTSW 8 110,660,655 (GRCm39) nonsense probably null
X0018:Phlpp2 UTSW 8 110,639,001 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAACGGAGTAACCTGCTG -3'
(R):5'- AGGCAATCCCACTACTGGAG -3'

Sequencing Primer
(F):5'- AGTAACCTGCTGCACCCG -3'
(R):5'- CAATCCCACTACTGGAGGAGGG -3'
Posted On 2019-06-26