Mutagenetix > Incidental Mutation

Incidental Mutation 'R7183:Dnah17'

559121

Institutional Source

Beutler Lab

Gene Symbol

Dnah17

Ensembl Gene

ENSMUSG00000033987

Gene Name

dynein, axonemal, heavy chain 17

Synonyms

LOC382552, Dnahcl1, 2810003K23Rik, Dnahc17

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118021723-118130634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 118129188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 11 (T11I)

Ref Sequence

ENSEMBL: ENSMUSP00000101915 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000100181] [ENSMUST00000106308] [ENSMUST00000132685]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000084803
AA Change: T11I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: T11I

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	183	766	8.5e-142	PFAM
low complexity region	1015	1028	N/A	INTRINSIC
Pfam:DHC_N2	1260	1673	5.8e-135	PFAM
Pfam:AAA_6	1793	2023	6e-161	PFAM
low complexity region	2092	2104	N/A	INTRINSIC
Pfam:AAA_5	2107	2243	7.8e-13	PFAM
Pfam:AAA_7	2400	2671	1.1e-171	PFAM
Pfam:AAA_8	2748	3015	4.9e-166	PFAM
Pfam:MT	3027	3370	3.4e-214	PFAM
Pfam:AAA_9	3388	3615	2.4e-144	PFAM
Pfam:Dynein_heavy	3742	4452	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100181

SMART Domains

Protein: ENSMUSP00000097756
Gene: ENSMUSG00000017132

Domain	Start	End	E-Value	Type
Sec7	73	258	1.38e-108	SMART
PH	275	392	1.65e-23	SMART
low complexity region	402	425	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106308
AA Change: T11I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: T11I

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	184	764	1.7e-152	PFAM
low complexity region	1015	1028	N/A	INTRINSIC
Pfam:DHC_N2	1262	1671	4.1e-132	PFAM
Pfam:AAA_6	1793	2023	7e-149	PFAM
low complexity region	2092	2104	N/A	INTRINSIC
Pfam:AAA_5	2107	2243	2.5e-11	PFAM
Pfam:AAA_7	2400	2671	4.4e-169	PFAM
Pfam:AAA_8	2748	3015	7.1e-163	PFAM
Pfam:MT	3027	3370	1.1e-210	PFAM
Pfam:AAA_9	3392	3614	1e-84	PFAM
Pfam:Dynein_heavy	3748	4479	3.5e-230	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: T11I

Domain	Start	End	E-Value	Type
Pfam:DHC_N2	279	688	3.1e-132	PFAM
Pfam:AAA_6	811	1041	5.3e-149	PFAM
low complexity region	1110	1122	N/A	INTRINSIC
Blast:AAA	1123	1354	1e-104	BLAST
Pfam:AAA_7	1452	1671	8.9e-134	PFAM
Pfam:AAA_8	1763	2030	5.4e-163	PFAM
Pfam:MT	2042	2168	6.8e-52	PFAM
Pfam:MT	2163	2412	8.2e-149	PFAM
Pfam:AAA_9	2434	2656	7.9e-85	PFAM
Pfam:Dynein_heavy	2790	3457	2.6e-209	PFAM
Pfam:Dynein_heavy	3460	3569	4.6e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Actn1	T	A	12: 80,168,932	M816L	possibly damaging	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Apba2	G	A	7: 64,733,545	D369N	probably benign	Het
Arhgap32	A	G	9: 32,186,383	N228D	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Crmp1	C	A	5: 37,288,817	H606N	probably benign	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Ehd1	A	G	19: 6,297,654	H346R	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Ercc5	A	T	1: 44,161,808		probably null	Het
Ercc5	G	T	1: 44,161,809		probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Masp2	A	G	4: 148,612,157	S404G	probably benign	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Pfkl	G	A	10: 78,002,082	R31*	probably null	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Thbs2	T	A	17: 14,690,116	I74F	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Vps33a	T	C	5: 123,535,215	Q436R	probably null	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Dnah17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Dnah17	APN	11	118088214	missense	possibly damaging	0.81
IGL00531:Dnah17	APN	11	118043173	missense	probably damaging	0.97
IGL00764:Dnah17	APN	11	118096485	missense	probably damaging	0.99
IGL00795:Dnah17	APN	11	118093634	missense	probably benign	0.35
IGL00823:Dnah17	APN	11	118047161	missense	probably benign	0.22
IGL01145:Dnah17	APN	11	118047173	missense	possibly damaging	0.63
IGL01433:Dnah17	APN	11	118049934	missense	probably damaging	1.00
IGL01454:Dnah17	APN	11	118058397	missense	probably damaging	1.00
IGL01545:Dnah17	APN	11	118119568	missense	probably damaging	1.00
IGL01548:Dnah17	APN	11	118098612	missense	probably benign	0.21
IGL01557:Dnah17	APN	11	118073686	missense	probably damaging	0.98
IGL01632:Dnah17	APN	11	118033881	missense	probably damaging	1.00
IGL01636:Dnah17	APN	11	118041056	missense	probably benign	0.03
IGL01672:Dnah17	APN	11	118042160	missense	probably damaging	0.97
IGL01822:Dnah17	APN	11	118081993	missense	probably damaging	1.00
IGL01869:Dnah17	APN	11	118052676	missense	probably benign	0.09
IGL01916:Dnah17	APN	11	118125288	missense	probably benign	0.00
IGL02131:Dnah17	APN	11	118072908	missense	probably damaging	1.00
IGL02154:Dnah17	APN	11	118124261	missense	probably benign	0.01
IGL02220:Dnah17	APN	11	118072967	nonsense	probably null
IGL02454:Dnah17	APN	11	118080767	missense	probably damaging	0.98
IGL02458:Dnah17	APN	11	118036350	missense	probably damaging	1.00
IGL02588:Dnah17	APN	11	118025653	missense	possibly damaging	0.95
IGL02865:Dnah17	APN	11	118073548	missense	probably damaging	1.00
IGL02881:Dnah17	APN	11	118042118	missense	probably damaging	1.00
IGL02952:Dnah17	APN	11	118088268	missense	probably benign	0.03
IGL03382:Dnah17	APN	11	118081943	missense	probably damaging	1.00
IGL03389:Dnah17	APN	11	118094979	missense	probably damaging	1.00
ergos	UTSW	11	118041158	splice site	probably benign
watt	UTSW	11	118080766	missense	probably damaging	0.96
PIT4280001:Dnah17	UTSW	11	118098582	missense	possibly damaging	0.85
R0004:Dnah17	UTSW	11	118060092	missense	possibly damaging	0.90
R0112:Dnah17	UTSW	11	118074434	missense	possibly damaging	0.82
R0116:Dnah17	UTSW	11	118058306	missense	probably benign	0.01
R0157:Dnah17	UTSW	11	118127171	missense	probably benign
R0320:Dnah17	UTSW	11	118052674	missense	possibly damaging	0.56
R0362:Dnah17	UTSW	11	118098539	missense	probably benign	0.10
R0382:Dnah17	UTSW	11	118128996	missense	probably damaging	1.00
R0383:Dnah17	UTSW	11	118067547	missense	probably benign
R0400:Dnah17	UTSW	11	118082078	missense	probably damaging	1.00
R0420:Dnah17	UTSW	11	118039939	missense	probably damaging	1.00
R0483:Dnah17	UTSW	11	118047124	missense	probably benign
R0533:Dnah17	UTSW	11	118110537	missense	possibly damaging	0.50
R0562:Dnah17	UTSW	11	118072900	missense	probably damaging	1.00
R0564:Dnah17	UTSW	11	118082981	missense	probably damaging	1.00
R0604:Dnah17	UTSW	11	118121471	missense	probably benign	0.00
R0608:Dnah17	UTSW	11	118090749	nonsense	probably null
R0614:Dnah17	UTSW	11	118070568	splice site	probably benign
R0632:Dnah17	UTSW	11	118067682	splice site	probably benign
R0831:Dnah17	UTSW	11	118060271	missense	probably damaging	0.99
R0838:Dnah17	UTSW	11	118060104	missense	probably damaging	1.00
R0879:Dnah17	UTSW	11	118056835	splice site	probably benign
R1061:Dnah17	UTSW	11	118052688	missense	possibly damaging	0.51
R1190:Dnah17	UTSW	11	118042175	missense	probably damaging	1.00
R1293:Dnah17	UTSW	11	118127137	critical splice donor site	probably null
R1297:Dnah17	UTSW	11	118121366	splice site	probably benign
R1332:Dnah17	UTSW	11	118043215	missense	possibly damaging	0.70
R1336:Dnah17	UTSW	11	118043215	missense	possibly damaging	0.70
R1364:Dnah17	UTSW	11	118125606	splice site	probably benign
R1418:Dnah17	UTSW	11	118074023	missense	probably damaging	0.98
R1432:Dnah17	UTSW	11	118023327	missense	probably damaging	1.00
R1497:Dnah17	UTSW	11	118114233	missense	probably damaging	1.00
R1500:Dnah17	UTSW	11	118101053	missense	probably benign
R1506:Dnah17	UTSW	11	118125387	missense	possibly damaging	0.53
R1512:Dnah17	UTSW	11	118095015	missense	probably benign
R1567:Dnah17	UTSW	11	118125985	missense	probably damaging	1.00
R1597:Dnah17	UTSW	11	118103498	splice site	probably benign
R1665:Dnah17	UTSW	11	118121495	splice site	probably benign
R1703:Dnah17	UTSW	11	118026749	missense	probably damaging	1.00
R1716:Dnah17	UTSW	11	118032598	missense	probably benign	0.00
R1727:Dnah17	UTSW	11	118070489	missense	probably damaging	0.98
R1727:Dnah17	UTSW	11	118096536	nonsense	probably null
R1728:Dnah17	UTSW	11	118069519	missense	possibly damaging	0.76
R1784:Dnah17	UTSW	11	118069519	missense	possibly damaging	0.76
R1852:Dnah17	UTSW	11	118121916	missense	probably damaging	0.97
R1869:Dnah17	UTSW	11	118047189	nonsense	probably null
R1886:Dnah17	UTSW	11	118108161	missense	possibly damaging	0.62
R1893:Dnah17	UTSW	11	118066968	missense	probably benign	0.00
R1954:Dnah17	UTSW	11	118024731	missense	probably damaging	1.00
R1969:Dnah17	UTSW	11	118104535	missense	probably benign	0.00
R1971:Dnah17	UTSW	11	118104535	missense	probably benign	0.00
R1975:Dnah17	UTSW	11	118096536	nonsense	probably null
R1977:Dnah17	UTSW	11	118112591	missense	possibly damaging	0.52
R2055:Dnah17	UTSW	11	118067531	missense	probably benign	0.00
R2115:Dnah17	UTSW	11	118119802	missense	probably benign	0.00
R2132:Dnah17	UTSW	11	118033747	missense	probably damaging	0.98
R2200:Dnah17	UTSW	11	118102409	splice site	probably benign
R2277:Dnah17	UTSW	11	118096561	missense	possibly damaging	0.81
R2279:Dnah17	UTSW	11	118096561	missense	possibly damaging	0.81
R2400:Dnah17	UTSW	11	118126384	critical splice acceptor site	probably null
R2402:Dnah17	UTSW	11	118125974	missense	probably benign	0.10
R2497:Dnah17	UTSW	11	118087024	splice site	probably null
R2923:Dnah17	UTSW	11	118093547	missense	probably damaging	1.00
R3121:Dnah17	UTSW	11	118041086	missense	probably damaging	1.00
R3236:Dnah17	UTSW	11	118094854	missense	probably benign	0.08
R3237:Dnah17	UTSW	11	118094854	missense	probably benign	0.08
R3498:Dnah17	UTSW	11	118080849	splice site	probably benign
R3499:Dnah17	UTSW	11	118080849	splice site	probably benign
R3746:Dnah17	UTSW	11	118082916	missense	probably benign	0.00
R3749:Dnah17	UTSW	11	118082916	missense	probably benign	0.00
R3762:Dnah17	UTSW	11	118104526	missense	probably benign	0.00
R3826:Dnah17	UTSW	11	118041158	splice site	probably benign
R3828:Dnah17	UTSW	11	118041158	splice site	probably benign
R3829:Dnah17	UTSW	11	118041158	splice site	probably benign
R3877:Dnah17	UTSW	11	118024707	missense	probably damaging	1.00
R3899:Dnah17	UTSW	11	118094808	missense	possibly damaging	0.78
R3900:Dnah17	UTSW	11	118094808	missense	possibly damaging	0.78
R3911:Dnah17	UTSW	11	118080849	splice site	probably benign
R3913:Dnah17	UTSW	11	118080849	splice site	probably benign
R3930:Dnah17	UTSW	11	118080849	splice site	probably benign
R3931:Dnah17	UTSW	11	118080849	splice site	probably benign
R3969:Dnah17	UTSW	11	118041158	splice site	probably benign
R3970:Dnah17	UTSW	11	118041158	splice site	probably benign
R4056:Dnah17	UTSW	11	118070538	missense	probably benign	0.05
R4113:Dnah17	UTSW	11	118112594	missense	possibly damaging	0.50
R4295:Dnah17	UTSW	11	118118772	missense	probably damaging	1.00
R4324:Dnah17	UTSW	11	118094213	missense	probably benign	0.01
R4412:Dnah17	UTSW	11	118073683	missense	probably damaging	1.00
R4413:Dnah17	UTSW	11	118025168	missense	probably benign	0.00
R4422:Dnah17	UTSW	11	118081973	missense	possibly damaging	0.91
R4552:Dnah17	UTSW	11	118052943	missense	possibly damaging	0.79
R4669:Dnah17	UTSW	11	118074293	missense	probably benign	0.02
R4677:Dnah17	UTSW	11	118119814	missense	probably damaging	1.00
R4716:Dnah17	UTSW	11	118073648	missense	probably benign	0.02
R4832:Dnah17	UTSW	11	118026780	missense	probably damaging	1.00
R4868:Dnah17	UTSW	11	118108212	missense	probably benign	0.03
R4897:Dnah17	UTSW	11	118078593	missense	probably damaging	1.00
R4928:Dnah17	UTSW	11	118027433	missense	probably damaging	1.00
R4937:Dnah17	UTSW	11	118042154	missense	probably damaging	1.00
R4957:Dnah17	UTSW	11	118074298	missense	probably benign	0.44
R5008:Dnah17	UTSW	11	118110577	missense	probably benign	0.01
R5016:Dnah17	UTSW	11	118080766	missense	probably damaging	0.96
R5027:Dnah17	UTSW	11	118102539	missense	probably benign	0.01
R5133:Dnah17	UTSW	11	118117113	missense	probably benign	0.00
R5140:Dnah17	UTSW	11	118086945	missense	probably damaging	1.00
R5146:Dnah17	UTSW	11	118114179	missense	probably damaging	0.99
R5151:Dnah17	UTSW	11	118027467	missense	probably damaging	1.00
R5153:Dnah17	UTSW	11	118082974	nonsense	probably null
R5192:Dnah17	UTSW	11	118034359	missense	possibly damaging	0.96
R5315:Dnah17	UTSW	11	118127283	missense	possibly damaging	0.79
R5317:Dnah17	UTSW	11	118127283	missense	possibly damaging	0.79
R5335:Dnah17	UTSW	11	118112514	missense	probably damaging	1.00
R5379:Dnah17	UTSW	11	118117203	intron	probably benign
R5396:Dnah17	UTSW	11	118127282	missense	probably benign
R5418:Dnah17	UTSW	11	118094984	missense	probably benign	0.04
R5534:Dnah17	UTSW	11	118052770	missense	possibly damaging	0.83
R5539:Dnah17	UTSW	11	118073660	missense	probably benign	0.03
R5594:Dnah17	UTSW	11	118043229	splice site	probably null
R5634:Dnah17	UTSW	11	118052926	splice site	probably null
R5696:Dnah17	UTSW	11	118101056	missense	probably benign	0.44
R5802:Dnah17	UTSW	11	118036446	missense	possibly damaging	0.79
R5826:Dnah17	UTSW	11	118034367	missense	probably damaging	1.00
R5873:Dnah17	UTSW	11	118056897	missense	probably benign	0.01
R5898:Dnah17	UTSW	11	118114213	missense	probably benign	0.00
R5934:Dnah17	UTSW	11	118041102	missense	probably benign
R6030:Dnah17	UTSW	11	118025549	missense	probably benign	0.32
R6030:Dnah17	UTSW	11	118025549	missense	probably benign	0.32
R6038:Dnah17	UTSW	11	118055889	missense	probably benign	0.00
R6038:Dnah17	UTSW	11	118055889	missense	probably benign	0.00
R6113:Dnah17	UTSW	11	118126275	missense	probably damaging	1.00
R6117:Dnah17	UTSW	11	118119571	missense	probably benign	0.00
R6137:Dnah17	UTSW	11	118025654	missense	probably damaging	1.00
R6173:Dnah17	UTSW	11	118039946	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126324	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126322	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126323	nonsense	probably null
R6260:Dnah17	UTSW	11	118126323	nonsense	probably null
R6260:Dnah17	UTSW	11	118126322	missense	probably damaging	1.00
R6260:Dnah17	UTSW	11	118126324	missense	probably damaging	1.00
R6278:Dnah17	UTSW	11	118126290	missense	probably damaging	0.99
R6298:Dnah17	UTSW	11	118108161	missense	probably benign	0.00
R6300:Dnah17	UTSW	11	118034310	missense	probably damaging	1.00
R6302:Dnah17	UTSW	11	118129155	missense	probably benign	0.09
R6363:Dnah17	UTSW	11	118110505	missense	probably benign
R6381:Dnah17	UTSW	11	118129185	missense	probably benign	0.08
R6418:Dnah17	UTSW	11	118129197	missense	probably damaging	0.99
R6660:Dnah17	UTSW	11	118100188	missense	probably benign
R6803:Dnah17	UTSW	11	118125372	missense	probably benign	0.00
R6820:Dnah17	UTSW	11	118069000	missense	probably damaging	0.99
R6885:Dnah17	UTSW	11	118090772	missense	possibly damaging	0.47
R6921:Dnah17	UTSW	11	118041484	missense	probably damaging	0.98
R6932:Dnah17	UTSW	11	118060079	missense	possibly damaging	0.95
R6954:Dnah17	UTSW	11	118066432	missense	probably damaging	1.00
R7000:Dnah17	UTSW	11	118025702	critical splice acceptor site	probably null
R7007:Dnah17	UTSW	11	118118871	missense	possibly damaging	0.92
R7048:Dnah17	UTSW	11	118046118	missense	possibly damaging	0.80
R7056:Dnah17	UTSW	11	118125386	missense	probably benign
R7131:Dnah17	UTSW	11	118079658	missense	probably benign	0.14
R7143:Dnah17	UTSW	11	118086130	missense	probably damaging	1.00
R7146:Dnah17	UTSW	11	118082110	missense	probably damaging	0.98
R7147:Dnah17	UTSW	11	118094929	missense	probably benign	0.31
R7172:Dnah17	UTSW	11	118041131	nonsense	probably null
R7297:Dnah17	UTSW	11	118055730	critical splice donor site	probably null
R7297:Dnah17	UTSW	11	118103356	missense	probably damaging	0.98
R7367:Dnah17	UTSW	11	118115196	missense	probably benign
R7398:Dnah17	UTSW	11	118080724	missense	probably damaging	0.96
R7426:Dnah17	UTSW	11	118090717	missense	probably null	0.79
R7524:Dnah17	UTSW	11	118121481	missense	probably benign	0.03
R7529:Dnah17	UTSW	11	118049866	critical splice donor site	probably null
R7615:Dnah17	UTSW	11	118110547	nonsense	probably null
R7681:Dnah17	UTSW	11	118025186	missense	probably damaging	1.00
R7702:Dnah17	UTSW	11	118025640	missense	probably benign	0.00
R7702:Dnah17	UTSW	11	118121478	missense	possibly damaging	0.64
R7713:Dnah17	UTSW	11	118025171	missense	probably benign	0.02
R7809:Dnah17	UTSW	11	118104636	missense	probably benign	0.09
R7842:Dnah17	UTSW	11	118079682	critical splice acceptor site	probably null
R7935:Dnah17	UTSW	11	118127222	missense	probably benign	0.20
R7951:Dnah17	UTSW	11	118118766	missense	possibly damaging	0.64
R8070:Dnah17	UTSW	11	118024671	missense	probably damaging	0.97
R8098:Dnah17	UTSW	11	118050367	missense	probably damaging	1.00
R8101:Dnah17	UTSW	11	118125918	missense	probably benign
R8177:Dnah17	UTSW	11	118128927	missense	possibly damaging	0.60
R8343:Dnah17	UTSW	11	118114195	missense	probably benign
R8350:Dnah17	UTSW	11	118087047	missense	probably damaging	0.98
R8393:Dnah17	UTSW	11	118057029	missense	probably damaging	1.00
R8401:Dnah17	UTSW	11	118024659	missense	probably damaging	0.96
R8418:Dnah17	UTSW	11	118103458	missense	probably benign	0.01
R8450:Dnah17	UTSW	11	118087047	missense	probably damaging	0.98
R8546:Dnah17	UTSW	11	118124275	missense	probably benign	0.00
R8697:Dnah17	UTSW	11	118086159	missense	possibly damaging	0.96
R8710:Dnah17	UTSW	11	118042147	missense	probably damaging	1.00
R8713:Dnah17	UTSW	11	118088202	missense	probably damaging	1.00
R8722:Dnah17	UTSW	11	118070457	nonsense	probably null
R8797:Dnah17	UTSW	11	118101375	missense	probably benign	0.00
R8953:Dnah17	UTSW	11	118125412	splice site	probably benign
R8965:Dnah17	UTSW	11	118024666	missense	probably damaging	1.00
R8976:Dnah17	UTSW	11	118026840	missense	probably damaging	1.00
R9090:Dnah17	UTSW	11	118041044	missense	probably damaging	1.00
R9128:Dnah17	UTSW	11	118046178	missense	possibly damaging	0.76
R9134:Dnah17	UTSW	11	118088146	missense	probably damaging	1.00
R9245:Dnah17	UTSW	11	118125677	missense	probably benign	0.02
R9251:Dnah17	UTSW	11	118121792	missense	probably benign	0.03
R9271:Dnah17	UTSW	11	118041044	missense	probably damaging	1.00
R9367:Dnah17	UTSW	11	118096638	missense	possibly damaging	0.95
R9367:Dnah17	UTSW	11	118121386	missense	possibly damaging	0.93
R9381:Dnah17	UTSW	11	118023393	missense	probably benign
R9405:Dnah17	UTSW	11	118118911	missense	probably benign
R9449:Dnah17	UTSW	11	118096626	missense	probably benign	0.07
R9517:Dnah17	UTSW	11	118024614	missense	possibly damaging	0.76
R9588:Dnah17	UTSW	11	118121957	missense	probably benign	0.00
R9629:Dnah17	UTSW	11	118088978	missense	probably damaging	1.00
R9654:Dnah17	UTSW	11	118036330	critical splice donor site	probably null
R9655:Dnah17	UTSW	11	118080823	missense	possibly damaging	0.94
R9662:Dnah17	UTSW	11	118034340	missense	probably damaging	0.97
R9686:Dnah17	UTSW	11	118088222	missense	possibly damaging	0.46
R9689:Dnah17	UTSW	11	118072905	missense	probably damaging	1.00
R9706:Dnah17	UTSW	11	118126200	missense	probably damaging	1.00
X0058:Dnah17	UTSW	11	118082925	missense	probably damaging	1.00
Z1176:Dnah17	UTSW	11	118127166	missense	probably benign	0.01
Z1177:Dnah17	UTSW	11	118078563	missense	possibly damaging	0.91
Z1177:Dnah17	UTSW	11	118086960	missense	probably damaging	1.00
Z1177:Dnah17	UTSW	11	118127142	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTAAACTCCTTTGGACTTGAGGG -3'
(R):5'- CAGGAAAACGCCCTTGTCAC -3'

Sequencing Primer
(F):5'- AGGGACTCTGGGAAGCC -3'
(R):5'- TTGTCACCAGCGCAACC -3'

Posted On

2019-06-26