Mutagenetix > Incidental Mutation

Incidental Mutation 'R7205:Tenm2'

560545

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.522) question?

Stock #

R7205 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 36049129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1390 (R1390Q)

Ref Sequence

ENSEMBL: ENSMUSP00000052014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057207
AA Change: R1390Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: R1390Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102801
AA Change: R1389Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: R1389Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163524
AA Change: R1389Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: R1389Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (99/102)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	T	10: 82,289,327	D2616E	probably benign	Het
5430419D17Rik	T	C	7: 131,277,623		probably null	Het
Abca15	A	T	7: 120,394,364	K1269M	possibly damaging	Het
Adgrl2	A	T	3: 148,858,949	Y332N	probably damaging	Het
Adgrv1	C	T	13: 81,479,658	V3695I	probably benign	Het
Aldh1l1	A	T	6: 90,598,275	Y848F	probably damaging	Het
Ambra1	T	C	2: 91,767,758	V88A	possibly damaging	Het
Ankrd12	C	T	17: 65,985,165	R1091Q	probably damaging	Het
Apob	T	G	12: 8,005,087	V1362G	probably damaging	Het
Arhgap17	A	G	7: 123,306,438	L328P	probably damaging	Het
Arhgap27	A	C	11: 103,344,541	V9G	probably benign	Het
Arhgap33	A	T	7: 30,533,009	D34E	probably damaging	Het
Ash1l	A	G	3: 88,965,952	D14G	probably benign	Het
Atf6b	T	C	17: 34,653,729	Y575H	probably damaging	Het
BC100530	T	C	16: 36,367,447	I19V	probably benign	Het
Bcl2l2	T	G	14: 54,884,601	S74A	probably benign	Het
Begain	T	C	12: 109,038,868	T73A	possibly damaging	Het
Bicdl1	C	T	5: 115,670,281	R264Q	probably damaging	Het
Ccdc180	A	G	4: 45,914,588	D701G	probably benign	Het
Cd200r4	G	T	16: 44,833,166	V146L	probably damaging	Het
Cd226	G	A	18: 89,247,198	C200Y	probably damaging	Het
Cdk12	A	G	11: 98,224,625	N864S	unknown	Het
Clcnkb	A	T	4: 141,408,635	L413Q	probably damaging	Het
Cldn10	T	C	14: 118,861,843	V123A	possibly damaging	Het
Cnn1	T	A	9: 22,105,782		probably null	Het
Cpa5	C	A	6: 30,630,830	Q364K	probably benign	Het
Ddx11	A	G	17: 66,130,771	E164G	probably benign	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Drc7	T	A	8: 95,077,921	Y855N	probably damaging	Het
Fam20b	C	A	1: 156,702,398		probably null	Het
Fip1l1	T	A	5: 74,588,075		probably null	Het
Flt4	A	G	11: 49,634,298	D657G	probably null	Het
Fmo3	T	A	1: 162,954,288	T499S	possibly damaging	Het
Fyco1	C	T	9: 123,822,426	G1190S	probably benign	Het
Galnt17	C	A	5: 131,306,752		probably benign	Het
Ggcx	T	C	6: 72,428,004	I465T	probably damaging	Het
Gm11238	A	G	4: 73,654,920	Y132C	probably damaging	Het
Gm281	T	C	14: 13,866,032	T286A		Het
Gm4788	A	T	1: 139,753,050	Y243*	probably null	Het
Gm7361	T	A	5: 26,261,118	N159K	probably damaging	Het
Golgb1	A	G	16: 36,875,301	N54S	unknown	Het
Grin2c	G	A	11: 115,251,050	P848S	probably damaging	Het
Grina	T	C	15: 76,249,087	V285A	probably damaging	Het
Gtpbp6	A	G	5: 110,104,612	L381P	probably damaging	Het
Herc2	G	T	7: 56,182,640	G3028V	probably damaging	Het
Ibsp	A	T	5: 104,310,431	Y278F	probably damaging	Het
Ints4	T	A	7: 97,535,226	L846*	probably null	Het
Kif17	A	G	4: 138,293,766	K849E	probably benign	Het
Krt77	G	A	15: 101,869,371	P83L	probably benign	Het
Ky	T	G	9: 102,542,292	D499E	probably damaging	Het
Lrp3	A	T	7: 35,202,626	M610K	probably damaging	Het
Lrrfip1	T	A	1: 91,091,616	D156E	probably benign	Het
Map6	C	A	7: 99,269,050	H343Q	probably benign	Het
Micu2	G	T	14: 57,954,149	D148E	probably benign	Het
Mks1	T	A	11: 87,856,602	S153T	probably benign	Het
Muc6	AGGCGCAGAAACCCTGGC	AGGC	7: 141,634,450		probably null	Het
Myh9	T	C	15: 77,783,472	K587R	probably benign	Het
Neb	T	C	2: 52,196,356	Y5478C	probably damaging	Het
Nelfe	G	A	17: 34,850,936		probably null	Het
Nps	T	A	7: 135,268,781	L11I	probably damaging	Het
Nsd1	A	T	13: 55,246,470	D731V	probably damaging	Het
Nup50	A	G	15: 84,933,658	T93A	probably benign	Het
Nup98	A	T	7: 102,195,041	F29Y	unknown	Het
Olfr1195	T	C	2: 88,683,423	H103R	possibly damaging	Het
Olfr1414	A	T	1: 92,511,851	M59K	probably benign	Het
Olfr212	A	G	6: 116,515,975	Y66C	probably damaging	Het
Olfr469	T	C	7: 107,822,575	N298S	probably benign	Het
Oprd1	A	G	4: 132,113,801	I282T	probably damaging	Het
Osbp2	T	C	11: 3,712,134	I240V	probably damaging	Het
Otub2	C	A	12: 103,392,904	P84Q	probably benign	Het
Parp9	A	T	16: 35,956,990	I435F	probably benign	Het
Pcdh18	C	T	3: 49,755,474	R464H	probably benign	Het
Pcsk6	G	T	7: 66,025,408		probably null	Het
Ptgs2	G	A	1: 150,102,761	R208Q	probably benign	Het
Rab11b	G	A	17: 33,749,867	R51C	probably damaging	Het
Rad1	A	G	15: 10,493,257	I257V	probably benign	Het
Rbms3	C	T	9: 116,586,017		probably null	Het
Rxfp2	A	T	5: 150,059,899	I300L	probably benign	Het
Rxfp2	C	A	5: 150,059,903	T301K	probably benign	Het
Sars2	G	T	7: 28,744,308	A112S	probably benign	Het
Scn10a	T	C	9: 119,613,550	D1543G	probably damaging	Het
Serpinb1b	A	G	13: 33,087,423	H59R	probably benign	Het
Sgsm2	T	A	11: 74,854,493	D661V	possibly damaging	Het
Smad6	C	A	9: 64,020,406	V207L	probably damaging	Het
Son	TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,295		probably benign	Het
Tmem132a	T	A	19: 10,866,931	Q101L	probably damaging	Het
Tmem151a	A	G	19: 5,082,773	V135A	probably damaging	Het
Trappc10	T	C	10: 78,210,428	K443E	probably damaging	Het
Trrap	A	T	5: 144,842,707	N3161I	possibly damaging	Het
Tspan32	G	T	7: 143,005,126	R6L	possibly damaging	Het
Ugt2a2	T	C	5: 87,460,609	D457G	possibly damaging	Het
Ulk2	A	T	11: 61,834,831	S140T	possibly damaging	Het
Upf1	C	T	8: 70,340,045	A338T	possibly damaging	Het
Usp43	C	T	11: 67,883,284	R460Q	probably null	Het
Uxs1	A	G	1: 43,816,958		probably benign	Het
Vmn1r59	A	G	7: 5,454,726	C12R	probably damaging	Het
Wdr64	A	G	1: 175,789,933	D693G	probably benign	Het
Wnk1	A	T	6: 119,943,878		probably null	Het
Wnt2	G	T	6: 18,028,047	R63S	probably benign	Het
Zcchc6	C	G	13: 59,788,550	D1246H	probably damaging	Het
Zfp418	A	T	7: 7,181,563	Q175L	probably benign	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTACCGTGCACATTTCACAC -3'
(R):5'- CCTGGTCCAAGCACATCATG -3'

Sequencing Primer
(F):5'- GTGCACATTTCACACTGACG -3'
(R):5'- CACATCATGCCCAGAGTAGG -3'

Posted On

2019-06-26