Incidental Mutation 'R7474:Tns3'
ID579352
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Nametensin 3
SynonymsTEM6, F830010I22Rik, Tens1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R7474 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location8431652-8664535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8530894 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 234 (Q234R)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
Predicted Effect probably damaging
Transcript: ENSMUST00000020695
AA Change: Q234R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: Q234R

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,088 C3089* probably null Het
Abcc1 A G 16: 14,472,986 T1487A possibly damaging Het
Agfg1 T A 1: 82,882,411 L333* probably null Het
Agfg2 C A 5: 137,653,868 V410F possibly damaging Het
Amotl2 T C 9: 102,730,111 V706A probably benign Het
Apob A T 12: 8,009,185 T2556S probably benign Het
Asb18 T A 1: 89,993,033 H174L possibly damaging Het
Atp10a G A 7: 58,658,527 E25K unknown Het
Aup1 T C 6: 83,054,967 L65P probably benign Het
Blvra T C 2: 127,086,849 F86L probably damaging Het
Cabp4 T C 19: 4,139,399 D53G probably benign Het
Cd300c2 T A 11: 114,998,296 E153V probably benign Het
Crxos A G 7: 15,902,931 E143G possibly damaging Het
Csmd2 A G 4: 128,546,127 N3125D Het
Cyp2c67 T A 19: 39,617,432 Q340L probably null Het
Dscam T A 16: 96,819,889 N540Y possibly damaging Het
E2f8 G A 7: 48,875,760 R155W probably damaging Het
Ext1 A T 15: 53,344,489 V292D probably damaging Het
Extl3 T C 14: 65,076,641 E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fsd1 A T 17: 55,988,149 D46V possibly damaging Het
Gcnt2 T A 13: 40,958,257 L374H probably damaging Het
Gm10309 G A 17: 86,504,667 probably benign Het
Gm13084 T C 4: 143,811,699 D234G probably benign Het
Gm14410 A T 2: 177,202,825 probably null Het
Gm5114 A T 7: 39,407,980 S738R probably benign Het
Gtf3c2 C A 5: 31,167,756 G502W probably damaging Het
Insc G A 7: 114,768,823 probably null Het
Kcnt2 T C 1: 140,570,478 Y898H possibly damaging Het
Kctd19 C A 8: 105,392,032 R299L probably benign Het
Klf10 T C 15: 38,297,202 N198S probably benign Het
L3mbtl1 A T 2: 162,966,604 D574V probably damaging Het
Lamc1 G A 1: 153,332,265 A92V possibly damaging Het
Lrrc63 T A 14: 75,126,203 T163S possibly damaging Het
Mak T A 13: 41,051,480 K127N probably damaging Het
Mdga2 G A 12: 66,486,761 Q945* probably null Het
Mthfr T A 4: 148,052,602 I519N possibly damaging Het
Mtmr2 C A 9: 13,799,225 H357N probably damaging Het
Myh13 A T 11: 67,327,164 E21V possibly damaging Het
Myh13 A C 11: 67,367,711 Q184P Het
Nans T A 4: 46,502,484 L307Q probably damaging Het
Ncan C A 8: 70,102,041 R1042L possibly damaging Het
Nrg3 T C 14: 39,011,999 E310G probably damaging Het
Obsl1 A C 1: 75,498,184 N857K probably benign Het
Olfml2a T C 2: 38,960,261 V663A probably damaging Het
Olfr1104 T C 2: 87,022,554 probably benign Het
Olfr116 T C 17: 37,624,386 D83G probably benign Het
Olfr213 G T 6: 116,541,038 C195F probably damaging Het
Olfr603 A G 7: 103,383,762 I80T probably damaging Het
Olfr621-ps1 C A 7: 103,629,147 W271L unknown Het
Pla2g4a T C 1: 149,865,200 M363V possibly damaging Het
Prickle1 A T 15: 93,508,671 V157D possibly damaging Het
Pstk A G 7: 131,373,633 N105S probably benign Het
Ptpn21 A G 12: 98,737,363 probably null Het
Rnf2 T A 1: 151,471,716 E277D probably benign Het
Rnpepl1 T C 1: 92,918,972 F532S probably benign Het
Rtn1 C T 12: 72,308,390 A261T possibly damaging Het
Ryr2 A G 13: 11,594,876 S4355P probably benign Het
Sacs T G 14: 61,211,178 L3558V probably benign Het
Senp6 T C 9: 80,142,328 V1047A probably damaging Het
Slco2b1 A T 7: 99,664,832 C515S probably damaging Het
Smgc T A 15: 91,860,694 V732E possibly damaging Het
Sorcs1 T C 19: 50,153,112 M1105V possibly damaging Het
Spats1 A G 17: 45,457,161 Y160H possibly damaging Het
Tnfsf14 T A 17: 57,190,848 D128V Het
Uxs1 A G 1: 43,757,024 V306A possibly damaging Het
Vac14 T A 8: 110,636,434 V304D probably damaging Het
Vangl1 A G 3: 102,184,249 F174L probably benign Het
Vav1 A G 17: 57,299,102 E242G probably benign Het
Vsir A G 10: 60,368,922 N305D probably benign Het
Vwce T A 19: 10,646,941 C399S possibly damaging Het
Wrn A T 8: 33,329,181 L248M probably damaging Het
Zfp141 T A 7: 42,476,254 K265* probably null Het
Zfp735 A T 11: 73,711,176 K315N possibly damaging Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8451066 missense probably benign 0.42
IGL00822:Tns3 APN 11 8443976 missense probably damaging 0.99
IGL01075:Tns3 APN 11 8478399 missense probably benign 0.45
IGL01286:Tns3 APN 11 8492617 missense probably benign 0.01
IGL01680:Tns3 APN 11 8548937 missense probably damaging 1.00
IGL01687:Tns3 APN 11 8492798 missense probably damaging 1.00
IGL01734:Tns3 APN 11 8519192 splice site probably benign
IGL01844:Tns3 APN 11 8437177 missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8548992 nonsense probably null
IGL02137:Tns3 APN 11 8492578 missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8434531 missense probably damaging 1.00
IGL02623:Tns3 APN 11 8437141 missense probably damaging 1.00
IGL02697:Tns3 APN 11 8492346 missense probably benign 0.00
IGL02829:Tns3 APN 11 8519564 missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8492149 missense probably benign 0.38
R0020:Tns3 UTSW 11 8545227 critical splice donor site probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0370:Tns3 UTSW 11 8445730 missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8445703 missense probably benign 0.07
R0410:Tns3 UTSW 11 8435852 missense probably benign 0.02
R0496:Tns3 UTSW 11 8547262 splice site probably benign
R0562:Tns3 UTSW 11 8493262 missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8493121 missense probably benign 0.04
R0736:Tns3 UTSW 11 8519474 missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8493302 missense probably damaging 1.00
R1367:Tns3 UTSW 11 8448704 missense probably benign 0.01
R1386:Tns3 UTSW 11 8518261 missense probably benign 0.02
R1975:Tns3 UTSW 11 8435738 missense probably benign 0.04
R2205:Tns3 UTSW 11 8531719 missense probably damaging 1.00
R2319:Tns3 UTSW 11 8541200 missense probably damaging 1.00
R2830:Tns3 UTSW 11 8435870 missense probably damaging 1.00
R3720:Tns3 UTSW 11 8492999 missense probably damaging 1.00
R3765:Tns3 UTSW 11 8451133 missense probably benign 0.00
R3817:Tns3 UTSW 11 8434619 missense probably damaging 1.00
R4058:Tns3 UTSW 11 8492275 missense probably damaging 1.00
R4599:Tns3 UTSW 11 8531747 missense probably damaging 1.00
R4631:Tns3 UTSW 11 8451119 missense probably benign 0.30
R4731:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4732:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4733:Tns3 UTSW 11 8450986 missense probably benign 0.28
R5472:Tns3 UTSW 11 8451092 missense probably benign
R5749:Tns3 UTSW 11 8451177 missense probably benign 0.01
R5807:Tns3 UTSW 11 8493211 missense probably damaging 1.00
R5844:Tns3 UTSW 11 8434580 missense probably damaging 1.00
R5942:Tns3 UTSW 11 8435860 missense probably damaging 1.00
R5982:Tns3 UTSW 11 8492245 missense probably damaging 0.99
R6025:Tns3 UTSW 11 8492578 missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8492987 missense probably damaging 1.00
R6322:Tns3 UTSW 11 8492147 missense probably benign 0.01
R6536:Tns3 UTSW 11 8434531 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549057 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549058 missense probably damaging 1.00
R6864:Tns3 UTSW 11 8493196 missense probably damaging 1.00
R6897:Tns3 UTSW 11 8531743 missense probably damaging 1.00
R7108:Tns3 UTSW 11 8437251 missense probably benign 0.00
R7443:Tns3 UTSW 11 8451442 missense probably benign 0.01
R7459:Tns3 UTSW 11 8492793 missense probably benign 0.16
R7576:Tns3 UTSW 11 8541192 missense possibly damaging 0.78
R8055:Tns3 UTSW 11 8545343 missense probably damaging 1.00
R8057:Tns3 UTSW 11 8492773 missense probably benign
R8077:Tns3 UTSW 11 8445667 missense probably damaging 1.00
T0975:Tns3 UTSW 11 8451146 missense probably benign 0.00
T0975:Tns3 UTSW 11 8479518 missense probably benign
T0975:Tns3 UTSW 11 8549100 start gained probably benign
X0005:Tns3 UTSW 11 8451224 missense probably benign 0.00
X0005:Tns3 UTSW 11 8479518 missense probably benign
Z1177:Tns3 UTSW 11 8451014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTACAGTCCTGAGGGTCACG -3'
(R):5'- AGAGCTTTCTCAAACCTTTTGACTG -3'

Sequencing Primer
(F):5'- AGTCCTGAGGGTCACGTTCTTC -3'
(R):5'- TGACTGATTTCCACAAGGTACAGC -3'
Posted On2019-10-07