Incidental Mutation 'R7629:Pde6h'
ID 589544
Institutional Source Beutler Lab
Gene Symbol Pde6h
Ensembl Gene ENSMUSG00000064330
Gene Name phosphodiesterase 6H, cGMP-specific, cone, gamma
Synonyms PDEgamma, A930033D18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 136923832-136968865 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 136959319 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 20 (R20L)
Ref Sequence ENSEMBL: ENSMUSP00000119246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137768] [ENSMUST00000204382] [ENSMUST00000204627]
AlphaFold P61249
Predicted Effect possibly damaging
Transcript: ENSMUST00000137768
AA Change: R20L

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119246
Gene: ENSMUSG00000064330
AA Change: R20L

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 83 4.7e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000204382
AA Change: R20L
SMART Domains Protein: ENSMUSP00000145119
Gene: ENSMUSG00000064330
AA Change: R20L

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 56 1.4e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204627
AA Change: R20L

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145191
Gene: ENSMUSG00000064330
AA Change: R20L

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 74 1.5e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the inhibitory (or gamma) subunit of the cone-specific cGMP phosphodiesterase, which is a tetramer composed of two catalytic chains (alpha and beta), and two inhibitory chains (gamma). It is specifically expressed in the retina, and is involved in the transmission and amplification of the visual signal. Mutations in this gene are associated with retinal cone dystrophy type 3A (RCD3A). [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous mutation of this gene does not affect the retina or photoreceptor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Pde6h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02488:Pde6h APN 6 136963266 splice site probably null
IGL03121:Pde6h APN 6 136959282 missense probably null
PIT4151001:Pde6h UTSW 6 136961187 missense possibly damaging 0.48
R1065:Pde6h UTSW 6 136959370 missense probably damaging 1.00
R2001:Pde6h UTSW 6 136963205 missense probably damaging 0.99
R2852:Pde6h UTSW 6 136963208 missense probably damaging 1.00
R4052:Pde6h UTSW 6 136959268 missense unknown
R4964:Pde6h UTSW 6 136961203 missense possibly damaging 0.92
R4966:Pde6h UTSW 6 136961203 missense possibly damaging 0.92
R7335:Pde6h UTSW 6 136963213 missense probably damaging 1.00
R9351:Pde6h UTSW 6 136959334 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAATAACTTCTCCGGTTTGCG -3'
(R):5'- GGATTTCAGGAATACCGACAGG -3'

Sequencing Primer
(F):5'- CTCCGGTTTGCGTGTGTCAAC -3'
(R):5'- TTTCAGGAATACCGACAGGATGAGC -3'
Posted On 2019-10-24