Mutagenetix > Incidental Mutations

Incidental Mutation 'R7629:Kndc1'

589550

Institutional Source

Beutler Lab

Gene Symbol

Kndc1

Ensembl Gene

ENSMUSG00000066129

Gene Name

kinase non-catalytic C-lobe domain (KIND) containing 1

Synonyms

B830014K08Rik, 2410012C07Rik, very-kind, VKIND

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7629 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

139894696-139941537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 139895260 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 25 (E25V)

Ref Sequence

ENSEMBL: ENSMUSP00000113856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053445
AA Change: E25V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: E25V

Domain	Start	End	E-Value	Type
KIND	37	217	4.66e-65	SMART
Blast:KIND	381	454	2e-10	BLAST
KIND	456	620	1.22e-50	SMART
low complexity region	658	670	N/A	INTRINSIC
low complexity region	755	771	N/A	INTRINSIC
low complexity region	792	801	N/A	INTRINSIC
low complexity region	949	965	N/A	INTRINSIC
coiled coil region	1121	1151	N/A	INTRINSIC
Pfam:RasGEF_N	1242	1341	2.2e-17	PFAM
Pfam:RasGEF	1464	1672	3.8e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121839
AA Change: E25V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129
AA Change: E25V

Domain	Start	End	E-Value	Type
KIND	37	217	4.66e-65	SMART
Blast:KIND	381	454	2e-10	BLAST
low complexity region	455	465	N/A	INTRINSIC
Blast:KIND	466	539	7e-32	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	G	A	16: 88,707,405	T168I	probably benign	Het
2410089E03Rik	C	T	15: 8,227,067	Q2004*	probably null	Het
Abtb2	T	A	2: 103,683,493		probably null	Het
Ankrd10	A	T	8: 11,615,769	V277E	probably benign	Het
Ankrd28	C	T	14: 31,715,264	V615I	probably benign	Het
Aqr	G	A	2: 114,114,593	P1079L	probably damaging	Het
Brox	G	A	1: 183,292,504	A60V	probably damaging	Het
Copg1	T	C	6: 87,894,169	V289A	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
D430042O09Rik	T	C	7: 125,795,250	L192P	probably damaging	Het
Dido1	T	C	2: 180,661,473	N1546S	probably benign	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dmxl1	T	A	18: 49,859,270	I361N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fhod3	T	A	18: 24,754,317	D88E	probably benign	Het
Flywch1	A	G	17: 23,755,770	M632T	probably benign	Het
Henmt1	A	G	3: 108,958,597	T213A	probably benign	Het
Itga9	T	C	9: 118,698,446	V555A	probably benign	Het
Kif13b	C	T	14: 64,779,335	R1317*	probably null	Het
Lingo2	T	A	4: 35,708,675	D435V	possibly damaging	Het
Lrrc14b	T	A	13: 74,361,164	M375L	probably benign	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mgat4c	G	A	10: 102,389,070	V382I	probably benign	Het
Mpp6	T	C	6: 50,196,623	I489T	probably benign	Het
Muc16	T	C	9: 18,566,785	T7075A	possibly damaging	Het
Myo5b	T	A	18: 74,627,254		probably null	Het
Neb	T	C	2: 52,273,961	D1995G	possibly damaging	Het
Nudt9	T	C	5: 104,050,694	V75A	possibly damaging	Het
Olfr1277	C	T	2: 111,269,876	V164I	probably benign	Het
Paf1	T	C	7: 28,395,068	Y35H	probably damaging	Het
Panx3	T	A	9: 37,661,444	Q270L	possibly damaging	Het
Pde6h	G	T	6: 136,959,319	R20L	possibly damaging	Het
Pdxk	A	G	10: 78,445,006	I200T	probably benign	Het
Ppara	A	T	15: 85,798,191	M363L	probably damaging	Het
Prmt8	A	T	6: 127,689,883	L376*	probably null	Het
Serpina1a	G	C	12: 103,853,808	T393R	probably damaging	Het
Sfxn1	C	T	13: 54,093,022	R178C	probably damaging	Het
Sirpb1c	A	T	3: 15,848,395	W7R	possibly damaging	Het
Skint5	T	C	4: 113,942,660	Y104C	probably damaging	Het
Slamf6	A	T	1: 171,936,624	T195S	probably damaging	Het
Slc2a6	T	C	2: 27,024,202	D301G	probably benign	Het
Stab2	A	T	10: 86,883,782		probably null	Het
Tctn3	C	G	19: 40,611,336	D141H	probably damaging	Het
Tnik	A	G	3: 28,661,728	N1164D	probably damaging	Het
Tpcn1	C	T	5: 120,537,937	V711I	probably benign	Het
Trim11	G	A	11: 58,978,334	G32D	probably damaging	Het
Usp32	TTTGGTTG	TTTG	11: 85,019,855		probably null	Het
Vmn1r72	T	C	7: 11,669,784	I246V	probably benign	Het
Zfp362	G	T	4: 128,786,055	R273S	probably damaging	Het
Zfp715	T	C	7: 43,301,676	D66G	possibly damaging	Het

Other mutations in Kndc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Kndc1	APN	7	139901988	splice site	probably benign
IGL01061:Kndc1	APN	7	139922694	missense	probably benign	0.00
IGL01099:Kndc1	APN	7	139920784	missense	probably damaging	1.00
IGL01522:Kndc1	APN	7	139913972	splice site	probably benign
IGL01767:Kndc1	APN	7	139930046	missense	probably damaging	1.00
IGL01884:Kndc1	APN	7	139914194	missense	probably damaging	1.00
IGL01932:Kndc1	APN	7	139923790	missense	probably damaging	0.98
IGL02133:Kndc1	APN	7	139920767	missense	probably benign	0.19
IGL02411:Kndc1	APN	7	139921913	critical splice donor site	probably null
IGL02472:Kndc1	APN	7	139910901	missense	probably benign	0.01
IGL02537:Kndc1	APN	7	139910410	missense	probably benign	0.01
IGL02708:Kndc1	APN	7	139901181	missense	probably damaging	1.00
IGL03115:Kndc1	APN	7	139921509	missense	probably benign	0.28
IGL03160:Kndc1	APN	7	139920689	nonsense	probably null
IGL03138:Kndc1	UTSW	7	139939878	missense	possibly damaging	0.89
PIT4142001:Kndc1	UTSW	7	139923776	frame shift	probably null
PIT4696001:Kndc1	UTSW	7	139932917	missense	probably damaging	1.00
R0349:Kndc1	UTSW	7	139910304	missense	probably benign	0.00
R0384:Kndc1	UTSW	7	139910599	missense	possibly damaging	0.85
R0415:Kndc1	UTSW	7	139930124	missense	probably damaging	1.00
R0421:Kndc1	UTSW	7	139908996	missense	probably damaging	1.00
R0487:Kndc1	UTSW	7	139914023	missense	probably null	0.19
R0530:Kndc1	UTSW	7	139901237	missense	probably damaging	1.00
R0905:Kndc1	UTSW	7	139923735	missense	possibly damaging	0.94
R1434:Kndc1	UTSW	7	139922684	missense	probably damaging	1.00
R1608:Kndc1	UTSW	7	139927408	missense	possibly damaging	0.80
R1644:Kndc1	UTSW	7	139930756	missense	probably damaging	1.00
R1835:Kndc1	UTSW	7	139927711	missense	probably damaging	0.99
R2012:Kndc1	UTSW	7	139921280	missense	possibly damaging	0.90
R2102:Kndc1	UTSW	7	139930761	missense	probably benign	0.02
R2103:Kndc1	UTSW	7	139921234	missense	probably benign	0.01
R2128:Kndc1	UTSW	7	139930112	missense	probably damaging	1.00
R2516:Kndc1	UTSW	7	139921822	missense	probably damaging	1.00
R3030:Kndc1	UTSW	7	139901207	missense	probably damaging	1.00
R3617:Kndc1	UTSW	7	139902060	splice site	probably benign
R3747:Kndc1	UTSW	7	139927904	critical splice donor site	probably null
R3848:Kndc1	UTSW	7	139908977	missense	probably damaging	1.00
R4028:Kndc1	UTSW	7	139930028	missense	probably damaging	0.98
R4043:Kndc1	UTSW	7	139924129	missense	probably benign	0.06
R4044:Kndc1	UTSW	7	139924129	missense	probably benign	0.06
R4095:Kndc1	UTSW	7	139937025	missense	possibly damaging	0.49
R4289:Kndc1	UTSW	7	139910882	missense	probably benign	0.01
R4478:Kndc1	UTSW	7	139920684	missense	probably damaging	1.00
R4514:Kndc1	UTSW	7	139910286	missense	probably benign	0.00
R4540:Kndc1	UTSW	7	139921427	nonsense	probably null
R4584:Kndc1	UTSW	7	139901243	missense	probably damaging	1.00
R4693:Kndc1	UTSW	7	139921779	missense	probably benign	0.02
R4705:Kndc1	UTSW	7	139930123	missense	possibly damaging	0.81
R4773:Kndc1	UTSW	7	139924031	nonsense	probably null
R4859:Kndc1	UTSW	7	139921905	missense	probably benign	0.03
R5004:Kndc1	UTSW	7	139932879	nonsense	probably null
R5037:Kndc1	UTSW	7	139910455	missense	possibly damaging	0.52
R5322:Kndc1	UTSW	7	139936809	missense	probably damaging	1.00
R5428:Kndc1	UTSW	7	139908962	missense	probably damaging	0.99
R5503:Kndc1	UTSW	7	139931889	missense	probably damaging	1.00
R5506:Kndc1	UTSW	7	139927891	missense	probably damaging	1.00
R5525:Kndc1	UTSW	7	139924111	missense	probably benign	0.00
R5888:Kndc1	UTSW	7	139895217	missense	probably benign	0.00
R5942:Kndc1	UTSW	7	139936879	missense	probably damaging	1.00
R5979:Kndc1	UTSW	7	139939827	missense	probably benign	0.05
R5990:Kndc1	UTSW	7	139927420	missense	probably damaging	0.99
R6038:Kndc1	UTSW	7	139923775	frame shift	probably null
R6076:Kndc1	UTSW	7	139902038	missense	probably damaging	1.00
R6118:Kndc1	UTSW	7	139923802	missense	probably damaging	1.00
R6151:Kndc1	UTSW	7	139921213	missense	probably benign	0.04
R6276:Kndc1	UTSW	7	139921063	missense	probably benign
R6367:Kndc1	UTSW	7	139913506	missense	probably damaging	1.00
R6726:Kndc1	UTSW	7	139922751	critical splice donor site	probably null
R6745:Kndc1	UTSW	7	139920976	missense	probably benign	0.02
R6886:Kndc1	UTSW	7	139913569	missense	probably benign	0.01
R6912:Kndc1	UTSW	7	139910278	missense	probably damaging	0.99
R7070:Kndc1	UTSW	7	139921828	missense	probably damaging	1.00
R7123:Kndc1	UTSW	7	139936836	missense	probably damaging	0.99
R7158:Kndc1	UTSW	7	139931860	missense	possibly damaging	0.48
R7248:Kndc1	UTSW	7	139920783	missense	probably damaging	1.00
R7437:Kndc1	UTSW	7	139909043	missense	probably damaging	1.00
R7564:Kndc1	UTSW	7	139920696	missense	probably benign	0.01
R7570:Kndc1	UTSW	7	139923775	frame shift	probably null
R7625:Kndc1	UTSW	7	139938017	missense	possibly damaging	0.90
R7726:Kndc1	UTSW	7	139939838	missense	possibly damaging	0.67
R7840:Kndc1	UTSW	7	139923816	missense	probably damaging	1.00
R7859:Kndc1	UTSW	7	139920964	missense	possibly damaging	0.57
R7923:Kndc1	UTSW	7	139923816	missense	probably damaging	1.00
R7942:Kndc1	UTSW	7	139920964	missense	possibly damaging	0.57
R8011:Kndc1	UTSW	7	139910620	missense	possibly damaging	0.90
R8062:Kndc1	UTSW	7	139918844	missense	probably benign	0.01
Z1177:Kndc1	UTSW	7	139921912	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- GGATCTGACCCAGAGAAAACCTG -3'
(R):5'- GCCAACTTTACAGGGACAGTC -3'

Sequencing Primer
(F):5'- CCCAGAGAAAACCTGCTGGG -3'
(R):5'- CATATAGCATTCCAGCTGTTCTGTGG -3'

Posted On

2019-10-24