Incidental Mutation 'R7629:Trim11'
ID 589558
Institutional Source Beutler Lab
Gene Symbol Trim11
Ensembl Gene ENSMUSG00000020455
Gene Name tripartite motif-containing 11
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 58978093-58991458 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 58978334 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 32 (G32D)
Ref Sequence ENSEMBL: ENSMUSP00000104438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093061] [ENSMUST00000108809] [ENSMUST00000108810]
AlphaFold Q99PQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000093061
AA Change: G32D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090749
Gene: ENSMUSG00000020455
AA Change: G32D

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
PRY 285 337 4.1e-24 SMART
SPRY 338 457 2.58e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108809
AA Change: G32D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104437
Gene: ENSMUSG00000020455
AA Change: G32D

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108810
AA Change: G32D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104438
Gene: ENSMUSG00000020455
AA Change: G32D

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
PRY 301 353 4.1e-24 SMART
SPRY 354 473 2.58e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nucleus and the cytoplasm. Its function has not been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Slc2a6 T C 2: 27,024,202 D301G probably benign Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Trim11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Trim11 APN 11 58990697 missense probably benign
R0453:Trim11 UTSW 11 58990535 missense probably damaging 1.00
R0565:Trim11 UTSW 11 58990584 missense probably damaging 1.00
R2061:Trim11 UTSW 11 58982063 missense probably damaging 1.00
R4783:Trim11 UTSW 11 58988924 missense probably null 1.00
R5004:Trim11 UTSW 11 58981338 critical splice donor site probably benign
R5847:Trim11 UTSW 11 58990593 missense probably damaging 1.00
R6027:Trim11 UTSW 11 58978463 missense possibly damaging 0.76
R6928:Trim11 UTSW 11 58988843 missense probably damaging 1.00
R7128:Trim11 UTSW 11 58978277 missense probably damaging 1.00
R7389:Trim11 UTSW 11 58990655 missense probably damaging 1.00
R7485:Trim11 UTSW 11 58978637 missense probably benign 0.00
R7535:Trim11 UTSW 11 58982065 missense probably damaging 0.99
R7734:Trim11 UTSW 11 58978354 missense probably damaging 1.00
R8220:Trim11 UTSW 11 58990394 missense probably damaging 1.00
R8229:Trim11 UTSW 11 58981341 splice site probably benign
Predicted Primers PCR Primer
(F):5'- AGCTTAGTGCCGGATGTACC -3'
(R):5'- AATGGAACGCACCTTGAGG -3'

Sequencing Primer
(F):5'- TAGTGCCGGATGTACCCACTAC -3'
(R):5'- TGAGTCCAGTGCTCCGAAC -3'
Posted On 2019-10-24