Incidental Mutation 'R8000:Mertk'
ID616309
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Namec-mer proto-oncogene tyrosine kinase
SynonymsNyk, nmf12, Tyro 12, Eyk, Mer
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R8000 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location128698956-128802894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128771498 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 478 (H478R)
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505]
Predicted Effect probably benign
Transcript: ENSMUST00000014505
AA Change: H478R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: H478R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik A G 2: 92,385,527 K69E unknown Het
4833423E24Rik A G 2: 85,518,726 V14A probably benign Het
Aadacl2 A G 3: 60,017,375 K121R possibly damaging Het
Acaca A G 11: 84,392,231 K2208E possibly damaging Het
Actn1 A G 12: 80,199,008 F134L probably damaging Het
Akt3 A T 1: 177,050,197 V335D probably damaging Het
Arhgef10 T G 8: 14,930,054 I98S probably damaging Het
Celf4 T C 18: 25,504,517 N209S probably benign Het
Col4a4 G A 1: 82,541,297 P59L unknown Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
Dock4 T A 12: 40,833,119 L1642I probably benign Het
Fam213a A C 14: 40,994,526 *230G probably null Het
Fap A G 2: 62,502,798 probably null Het
Fbxo18 A T 2: 11,767,289 Y194N probably benign Het
Fras1 A G 5: 96,762,677 T3322A probably damaging Het
Gabra4 A G 5: 71,623,961 F369S probably damaging Het
Igkv9-124 T A 6: 67,942,152 D92V probably damaging Het
Kcna6 C A 6: 126,738,985 E314* probably null Het
Kyat1 A C 2: 30,192,053 S25A probably benign Het
Lars2 G A 9: 123,436,244 G455D probably damaging Het
Mier1 A T 4: 103,131,043 T83S probably damaging Het
Mmp1a C A 9: 7,476,214 H437Q probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Neb G T 2: 52,288,844 A1300D probably damaging Het
Nell2 T A 15: 95,435,274 L167F probably damaging Het
Olfr1426 T C 19: 12,087,994 D266G probably damaging Het
Olfr239 G C 17: 33,199,347 A100P probably damaging Het
Olfr527 T A 7: 140,336,342 M160K possibly damaging Het
Pald1 T C 10: 61,347,439 T339A probably benign Het
Pex13 A C 11: 23,655,915 L105W probably damaging Het
Ptprd A C 4: 76,066,242 F556V possibly damaging Het
Rgp1 T A 4: 43,581,664 C314S probably benign Het
Rnaseh2a G A 8: 84,966,049 probably benign Het
Rpl7 A T 1: 16,102,725 M154K probably benign Het
Samd9l A T 6: 3,373,034 L1409Q probably damaging Het
Slc35f3 A G 8: 126,321,073 T51A probably benign Het
Slc7a10 A G 7: 35,200,440 Y76C Het
Slk G T 19: 47,608,905 A51S Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Stk38 A T 17: 28,992,448 V51E probably benign Het
Tecta A T 9: 42,367,184 C1009* probably null Het
Vmn1r228 A T 17: 20,776,965 M97K possibly damaging Het
Xpo4 T C 14: 57,589,946 D931G probably damaging Het
Zfp503 T C 14: 21,986,159 T230A possibly damaging Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R0628:Mertk UTSW 2 128738313 missense probably damaging 1.00
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4664:Mertk UTSW 2 128801212 missense probably benign 0.24
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R5987:Mertk UTSW 2 128771374 missense probably benign 0.01
R6127:Mertk UTSW 2 128738291 missense probably damaging 0.99
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6671:Mertk UTSW 2 128752023 critical splice donor site probably null
R6674:Mertk UTSW 2 128729357 missense probably benign
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
R7883:Mertk UTSW 2 128776345 missense probably benign 0.01
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGTCTCAGCGTTTCG -3'
(R):5'- ATGGTGTCATGGGCCTTAAACC -3'

Sequencing Primer
(F):5'- ATGTCTCAGCGTTTCGTTTCC -3'
(R):5'- CAGGTAGAGCCCAATTCAGTATTTGG -3'
Posted On2020-01-23