Incidental Mutation 'R8126:Lrrk1'
List |< first << previous [record 21 of 43] next >> last >|
ID631761
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Nameleucine-rich repeat kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location66226912-66388350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66292315 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 725 (N725S)
Ref Sequence ENSEMBL: ENSMUSP00000015277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277]
Predicted Effect probably damaging
Transcript: ENSMUST00000015277
AA Change: N725S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: N725S

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 66287701 missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 66265450 missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 66279416 missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 66308659 critical splice donor site probably null
IGL02679:Lrrk1 APN 7 66274872 missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 66330767 missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 66308691 missense probably benign 0.12
IGL02878:Lrrk1 APN 7 66262563 missense probably benign
IGL03135:Lrrk1 APN 7 66262890 missense probably benign 0.00
IGL03191:Lrrk1 APN 7 66259959 missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 66306894 missense probably damaging 1.00
combustion UTSW 7 66262665 missense possibly damaging 0.94
Heiland UTSW 7 66262733 missense probably damaging 0.96
liebster UTSW 7 66294981 missense probably damaging 1.00
magi UTSW 7 66281648 missense probably damaging 1.00
oxidation UTSW 7 66279372 missense probably benign 0.00
phlogiston UTSW 7 66278520 splice site probably benign
Savior UTSW 7 66262487 missense probably damaging 1.00
wenig UTSW 7 66273001 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 66296263 splice site probably benign
R0505:Lrrk1 UTSW 7 66290908 splice site probably null
R0609:Lrrk1 UTSW 7 66266615 splice site probably null
R0650:Lrrk1 UTSW 7 66292336 missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 66294981 missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 66262283 missense probably benign 0.00
R1435:Lrrk1 UTSW 7 66273028 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 66302671 nonsense probably null
R1620:Lrrk1 UTSW 7 66381538 missense probably benign 0.00
R1884:Lrrk1 UTSW 7 66262437 missense probably benign
R1891:Lrrk1 UTSW 7 66279300 missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 66281684 missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 66279282 missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 66330750 missense probably damaging 1.00
R2144:Lrrk1 UTSW 7 66296163 missense probably damaging 0.98
R2147:Lrrk1 UTSW 7 66285411 splice site probably null
R3176:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3886:Lrrk1 UTSW 7 66292364 missense probably damaging 1.00
R3893:Lrrk1 UTSW 7 66278520 splice site probably benign
R3906:Lrrk1 UTSW 7 66294903 missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 66330764 missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4653:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4672:Lrrk1 UTSW 7 66279372 missense probably benign 0.00
R4693:Lrrk1 UTSW 7 66262487 missense probably damaging 1.00
R4729:Lrrk1 UTSW 7 66262293 missense probably benign
R4737:Lrrk1 UTSW 7 66306873 missense probably benign 0.09
R4795:Lrrk1 UTSW 7 66262665 missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 66295454 missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 66332363 missense probably damaging 1.00
R5254:Lrrk1 UTSW 7 66307107 missense probably benign 0.00
R5407:Lrrk1 UTSW 7 66270797 missense probably benign 0.20
R5482:Lrrk1 UTSW 7 66330670 missense probably benign
R5600:Lrrk1 UTSW 7 66307215 missense probably benign 0.31
R5615:Lrrk1 UTSW 7 66287615 missense probably damaging 1.00
R6041:Lrrk1 UTSW 7 66262133 missense probably benign
R6211:Lrrk1 UTSW 7 66302710 missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 66307103 critical splice donor site probably null
R6276:Lrrk1 UTSW 7 66306839 splice site probably null
R6447:Lrrk1 UTSW 7 66302728 missense probably benign 0.19
R6478:Lrrk1 UTSW 7 66262733 missense probably damaging 0.96
R6615:Lrrk1 UTSW 7 66281648 missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 66273001 missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 66342779 missense probably benign 0.05
R6995:Lrrk1 UTSW 7 66292342 missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 66287443 missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 66285279 missense probably benign 0.06
R7203:Lrrk1 UTSW 7 66270825 missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 66332386 missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 66262155 missense probably benign
R7440:Lrrk1 UTSW 7 66290854 missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 66262562 missense probably benign
R7593:Lrrk1 UTSW 7 66308691 missense probably benign 0.12
R7728:Lrrk1 UTSW 7 66262715 missense probably benign 0.00
R7993:Lrrk1 UTSW 7 66262454 missense probably benign 0.00
R8009:Lrrk1 UTSW 7 66265474 missense possibly damaging 0.82
R8037:Lrrk1 UTSW 7 66285341 missense probably benign
R8101:Lrrk1 UTSW 7 66342782 missense probably benign
R8116:Lrrk1 UTSW 7 66262623 missense possibly damaging 0.95
R8278:Lrrk1 UTSW 7 66278684 missense probably benign 0.37
RF018:Lrrk1 UTSW 7 66381502 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACACTGACTGAGCCCTTGAG -3'
(R):5'- TTTCCAGATGCGTTCCAAGTTG -3'

Sequencing Primer
(F):5'- TGGGGGAGCCCTTCAACAAG -3'
(R):5'- CGTTCCAAGTTGTACGTTTTATTG -3'
Posted On2020-06-30