Incidental Mutation 'R8206:Ppp1r35'
ID 635906
Institutional Source Beutler Lab
Gene Symbol Ppp1r35
Ensembl Gene ENSMUSG00000029725
Gene Name protein phosphatase 1, regulatory subunit 35
Synonyms 2010007H12Rik, 2010011D20Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8206 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 137778849-137780110 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 137780034 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 97 (I97K)
Ref Sequence ENSEMBL: ENSMUSP00000143182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031739] [ENSMUST00000031740] [ENSMUST00000196022] [ENSMUST00000198929]
AlphaFold Q9D8C8
Predicted Effect probably benign
Transcript: ENSMUST00000031739
SMART Domains Protein: ENSMUSP00000031739
Gene: ENSMUSG00000029725

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:PPP1R35_C 107 255 1.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031740
SMART Domains Protein: ENSMUSP00000031740
Gene: ENSMUSG00000029726

DomainStartEndE-ValueType
low complexity region 14 19 N/A INTRINSIC
low complexity region 49 74 N/A INTRINSIC
low complexity region 115 121 N/A INTRINSIC
low complexity region 130 136 N/A INTRINSIC
low complexity region 234 254 N/A INTRINSIC
low complexity region 307 352 N/A INTRINSIC
low complexity region 355 376 N/A INTRINSIC
Pfam:Methyltransf_23 398 623 2.7e-14 PFAM
Pfam:PrmA 408 489 6.9e-6 PFAM
Pfam:Methyltransf_31 419 480 9.3e-9 PFAM
Pfam:Methyltransf_18 420 595 1.8e-13 PFAM
Pfam:Bin3 552 660 4.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126126
SMART Domains Protein: ENSMUSP00000114480
Gene: ENSMUSG00000029725

DomainStartEndE-ValueType
Pfam:PPP1R35_C 48 144 2.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132726
SMART Domains Protein: ENSMUSP00000118688
Gene: ENSMUSG00000029726

DomainStartEndE-ValueType
Pfam:Methyltransf_11 33 99 8e-6 PFAM
Pfam:Bin3 59 167 8.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196022
Predicted Effect unknown
Transcript: ENSMUST00000198929
AA Change: I97K
SMART Domains Protein: ENSMUSP00000143182
Gene: ENSMUSG00000029725
AA Change: I97K

DomainStartEndE-ValueType
low complexity region 66 77 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Flvcr2 GTAGTGTATA GTA 12: 85,803,148 probably null Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Ppp1r35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ppp1r35 APN 5 137779537 missense probably damaging 0.98
IGL02015:Ppp1r35 APN 5 137780031 unclassified probably benign
R2091:Ppp1r35 UTSW 5 137779894 missense possibly damaging 0.61
R2155:Ppp1r35 UTSW 5 137780005 missense probably benign 0.01
R5249:Ppp1r35 UTSW 5 137779144 unclassified probably benign
R5264:Ppp1r35 UTSW 5 137780024 unclassified probably benign
R7436:Ppp1r35 UTSW 5 137780017 nonsense probably null
R8803:Ppp1r35 UTSW 5 137779469 missense possibly damaging 0.93
R9389:Ppp1r35 UTSW 5 137779315 missense probably damaging 1.00
R9524:Ppp1r35 UTSW 5 137779042 missense unknown
Z1177:Ppp1r35 UTSW 5 137778943 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCACCTCGAGTGTAACCTG -3'
(R):5'- ACACTTGGGACAGTGCTTTC -3'

Sequencing Primer
(F):5'- GCTTCACCTTCCCATAGGAGG -3'
(R):5'- CTTTCCACTTGCCATGGGGG -3'
Posted On 2020-07-13