Incidental Mutation 'R8206:Ppp1r35'
ID635906
Institutional Source Beutler Lab
Gene Symbol Ppp1r35
Ensembl Gene ENSMUSG00000029725
Gene Nameprotein phosphatase 1, regulatory subunit 35
Synonyms2010007H12Rik, 2010011D20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137778849-137780110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137780034 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 97 (I97K)
Ref Sequence ENSEMBL: ENSMUSP00000143182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031739] [ENSMUST00000031740] [ENSMUST00000196022] [ENSMUST00000198929]
Predicted Effect probably benign
Transcript: ENSMUST00000031739
SMART Domains Protein: ENSMUSP00000031739
Gene: ENSMUSG00000029725

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:PPP1R35_C 107 255 1.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031740
SMART Domains Protein: ENSMUSP00000031740
Gene: ENSMUSG00000029726

DomainStartEndE-ValueType
low complexity region 14 19 N/A INTRINSIC
low complexity region 49 74 N/A INTRINSIC
low complexity region 115 121 N/A INTRINSIC
low complexity region 130 136 N/A INTRINSIC
low complexity region 234 254 N/A INTRINSIC
low complexity region 307 352 N/A INTRINSIC
low complexity region 355 376 N/A INTRINSIC
Pfam:Methyltransf_23 398 623 2.7e-14 PFAM
Pfam:PrmA 408 489 6.9e-6 PFAM
Pfam:Methyltransf_31 419 480 9.3e-9 PFAM
Pfam:Methyltransf_18 420 595 1.8e-13 PFAM
Pfam:Bin3 552 660 4.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126126
SMART Domains Protein: ENSMUSP00000114480
Gene: ENSMUSG00000029725

DomainStartEndE-ValueType
Pfam:PPP1R35_C 48 144 2.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132726
SMART Domains Protein: ENSMUSP00000118688
Gene: ENSMUSG00000029726

DomainStartEndE-ValueType
Pfam:Methyltransf_11 33 99 8e-6 PFAM
Pfam:Bin3 59 167 8.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196022
Predicted Effect unknown
Transcript: ENSMUST00000198929
AA Change: I97K
SMART Domains Protein: ENSMUSP00000143182
Gene: ENSMUSG00000029725
AA Change: I97K

DomainStartEndE-ValueType
low complexity region 66 77 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Ppp1r35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ppp1r35 APN 5 137779537 missense probably damaging 0.98
IGL02015:Ppp1r35 APN 5 137780031 unclassified probably benign
R2091:Ppp1r35 UTSW 5 137779894 missense possibly damaging 0.61
R2155:Ppp1r35 UTSW 5 137780005 missense probably benign 0.01
R5249:Ppp1r35 UTSW 5 137779144 unclassified probably benign
R5264:Ppp1r35 UTSW 5 137780024 unclassified probably benign
R7436:Ppp1r35 UTSW 5 137780017 nonsense probably null
Z1177:Ppp1r35 UTSW 5 137778943 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCACCTCGAGTGTAACCTG -3'
(R):5'- ACACTTGGGACAGTGCTTTC -3'

Sequencing Primer
(F):5'- GCTTCACCTTCCCATAGGAGG -3'
(R):5'- CTTTCCACTTGCCATGGGGG -3'
Posted On2020-07-13