Incidental Mutation 'R9209:Adamts5'
ID 698743
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms 9530092O11Rik, ADAM-TS5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9209 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 85856173-85901828 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85870083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 507 (V507A)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
AlphaFold Q9R001
Predicted Effect probably damaging
Transcript: ENSMUST00000023611
AA Change: V507A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: V507A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,413 N513K possibly damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Ap3d1 A G 10: 80,719,084 V469A probably benign Het
Arhgef4 G T 1: 34,725,160 probably null Het
Arhgef4 A T 1: 34,810,495 Q389L probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Azin2 T C 4: 128,947,548 E275G probably damaging Het
Bhlhe23 A G 2: 180,776,350 S132P probably damaging Het
Capn12 A G 7: 28,881,818 Y32C probably damaging Het
Celsr2 A T 3: 108,414,033 S488T probably benign Het
Cenpx A G 11: 120,711,756 V27A possibly damaging Het
Clca2 G A 3: 145,072,244 P760L probably benign Het
Clstn3 T C 6: 124,431,612 S951G probably benign Het
Clybl C A 14: 122,384,258 P286Q probably benign Het
Cmya5 T A 13: 93,090,358 M2741L probably benign Het
Cntnap2 G A 6: 47,049,249 G944E probably damaging Het
Col8a1 A C 16: 57,626,920 Y742* probably null Het
Crb1 T C 1: 139,243,313 K780E probably damaging Het
Crygc T A 1: 65,073,217 Y66F probably benign Het
Cyp2b9 G A 7: 26,173,579 G49E possibly damaging Het
D130043K22Rik T C 13: 24,857,107 S171P possibly damaging Het
Dhx36 T C 3: 62,471,474 I890V probably benign Het
Dpp9 C T 17: 56,205,765 G148S probably damaging Het
Eml6 G T 11: 29,831,175 S619Y probably damaging Het
Enpp4 A T 17: 44,101,361 L319* probably null Het
Esyt1 T C 10: 128,525,487 S113G probably benign Het
Fat1 A G 8: 44,951,754 D514G possibly damaging Het
Fbxo16 G A 14: 65,287,145 R38Q probably damaging Het
Fchsd1 A T 18: 37,959,653 M668K unknown Het
Gpr149 C T 3: 62,603,672 S302N probably benign Het
Gsap A G 5: 21,228,066 K258E probably benign Het
Helq C A 5: 100,791,352 V443F probably benign Het
Helq T A 5: 100,791,353 K442N probably damaging Het
Ighv1-37 T C 12: 114,896,503 E29G possibly damaging Het
Ighv1-9 C A 12: 114,584,000 M1I probably null Het
Itga6 T G 2: 71,841,133 F743V probably benign Het
Lpin1 C A 12: 16,538,547 D881Y Het
Lypd8 T A 11: 58,382,814 C40S possibly damaging Het
Macf1 C T 4: 123,432,434 R5092Q probably damaging Het
Mcm7 A G 5: 138,168,331 probably null Het
Micall2 G A 5: 139,710,415 T831I unknown Het
Myo18b A T 5: 112,875,061 M155K unknown Het
Nckap5 T A 1: 125,940,191 H201L unknown Het
Ndst2 A T 14: 20,729,172 D333E possibly damaging Het
Nlgn1 A G 3: 25,912,640 probably null Het
Nup188 T G 2: 30,342,385 Y1483D probably benign Het
Olfr1214 A C 2: 88,987,713 L163* probably null Het
Olfr490 T A 7: 108,286,319 Y269F probably benign Het
Olfr503 A C 7: 108,545,457 I311L probably benign Het
Olfr629 T A 7: 103,741,112 S43C probably benign Het
Olfr952 T A 9: 39,426,339 H244L probably damaging Het
Peg3 A C 7: 6,708,227 I1332S possibly damaging Het
Piezo2 T C 18: 63,021,301 K2469R probably damaging Het
Pik3cg T C 12: 32,197,313 M804V probably damaging Het
Polq A T 16: 37,048,649 I794F possibly damaging Het
Rasgef1b A G 5: 99,222,332 V437A probably benign Het
Rdm1 T A 11: 101,628,031 D21E probably benign Het
Ripk4 G T 16: 97,750,111 Q219K possibly damaging Het
Ropn1l T C 15: 31,441,325 I217V Het
Sdf2 T C 11: 78,246,032 S13P unknown Het
Selenbp1 A G 3: 94,939,768 T202A probably benign Het
Slfn5 T C 11: 82,960,107 F410S possibly damaging Het
Srrm2 A G 17: 23,820,906 T2175A probably benign Het
St6galnac3 T C 3: 153,411,723 Y121C possibly damaging Het
Stat1 A G 1: 52,145,178 N417S probably benign Het
Tead1 T C 7: 112,876,171 F276L probably damaging Het
Teddm3 A T 16: 21,152,987 S277R probably benign Het
Tmc2 A G 2: 130,261,397 probably null Het
Tmem156 G A 5: 65,073,784 L248F probably damaging Het
Tnn T C 1: 160,126,416 S590G probably benign Het
Trmt44 A G 5: 35,574,078 probably null Het
Upp2 T A 2: 58,778,010 Y238* probably null Het
Usp32 T C 11: 85,040,012 T531A probably damaging Het
Vmn2r78 A T 7: 86,920,223 D108V probably benign Het
Wdfy3 G T 5: 101,930,964 A824E probably benign Het
Xylt1 T C 7: 117,656,647 V814A probably benign Het
Zfy1 C T Y: 732,990 R281H unknown Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85866642 missense probably benign 0.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85899484 missense probably damaging 0.99
R0669:Adamts5 UTSW 16 85899726 missense probably benign 0.45
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R1946:Adamts5 UTSW 16 85899243 missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85868121 missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85868643 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R6829:Adamts5 UTSW 16 85870071 missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85863035 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
R7384:Adamts5 UTSW 16 85899826 missense probably benign 0.02
R7452:Adamts5 UTSW 16 85877981 missense probably benign 0.00
R7727:Adamts5 UTSW 16 85899966 missense probably damaging 1.00
R7785:Adamts5 UTSW 16 85863004 missense probably damaging 0.99
R7894:Adamts5 UTSW 16 85877920 nonsense probably null
R8111:Adamts5 UTSW 16 85899315 missense probably damaging 1.00
R8370:Adamts5 UTSW 16 85899993 missense possibly damaging 0.74
R8413:Adamts5 UTSW 16 85866618 critical splice donor site probably null
R8505:Adamts5 UTSW 16 85900056 missense probably benign 0.42
R8804:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R9455:Adamts5 UTSW 16 85870129 missense probably damaging 0.99
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Z1177:Adamts5 UTSW 16 85870074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTGGAAAAGCACTTCC -3'
(R):5'- ACTTCTTAGGTCGCTGGTTATAGC -3'

Sequencing Primer
(F):5'- GTGTTGGGTCTCGCCACTTAC -3'
(R):5'- GGTCGCTGGTTATAGCAATTTGAAAC -3'
Posted On 2022-02-07