Mutagenetix > Incidental Mutations

Incidental Mutation 'R9209:Adamts5'

698743

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.196) question?

Stock #

R9209 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85870083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 507 (V507A)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably damaging
Transcript: ENSMUST00000023611
AA Change: V507A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: V507A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	A	7: 41,626,413	N513K	possibly damaging	Het
Actl6a	T	A	3: 32,725,320	I399N	probably damaging	Het
Ap3d1	A	G	10: 80,719,084	V469A	probably benign	Het
Arhgef4	G	T	1: 34,725,160		probably null	Het
Arhgef4	A	T	1: 34,810,495	Q389L	probably benign	Het
Atad2	A	G	15: 58,116,798	V106A	possibly damaging	Het
Azin2	T	C	4: 128,947,548	E275G	probably damaging	Het
Bhlhe23	A	G	2: 180,776,350	S132P	probably damaging	Het
Capn12	A	G	7: 28,881,818	Y32C	probably damaging	Het
Celsr2	A	T	3: 108,414,033	S488T	probably benign	Het
Cenpx	A	G	11: 120,711,756	V27A	possibly damaging	Het
Clca2	G	A	3: 145,072,244	P760L	probably benign	Het
Clstn3	T	C	6: 124,431,612	S951G	probably benign	Het
Clybl	C	A	14: 122,384,258	P286Q	probably benign	Het
Cmya5	T	A	13: 93,090,358	M2741L	probably benign	Het
Cntnap2	G	A	6: 47,049,249	G944E	probably damaging	Het
Col8a1	A	C	16: 57,626,920	Y742*	probably null	Het
Crb1	T	C	1: 139,243,313	K780E	probably damaging	Het
Crygc	T	A	1: 65,073,217	Y66F	probably benign	Het
Cyp2b9	G	A	7: 26,173,579	G49E	possibly damaging	Het
D130043K22Rik	T	C	13: 24,857,107	S171P	possibly damaging	Het
Dhx36	T	C	3: 62,471,474	I890V	probably benign	Het
Dpp9	C	T	17: 56,205,765	G148S	probably damaging	Het
Eml6	G	T	11: 29,831,175	S619Y	probably damaging	Het
Enpp4	A	T	17: 44,101,361	L319*	probably null	Het
Esyt1	T	C	10: 128,525,487	S113G	probably benign	Het
Fat1	A	G	8: 44,951,754	D514G	possibly damaging	Het
Fbxo16	G	A	14: 65,287,145	R38Q	probably damaging	Het
Fchsd1	A	T	18: 37,959,653	M668K	unknown	Het
Gpr149	C	T	3: 62,603,672	S302N	probably benign	Het
Gsap	A	G	5: 21,228,066	K258E	probably benign	Het
Helq	C	A	5: 100,791,352	V443F	probably benign	Het
Helq	T	A	5: 100,791,353	K442N	probably damaging	Het
Ighv1-37	T	C	12: 114,896,503	E29G	possibly damaging	Het
Ighv1-9	C	A	12: 114,584,000	M1I	probably null	Het
Itga6	T	G	2: 71,841,133	F743V	probably benign	Het
Lpin1	C	A	12: 16,538,547	D881Y		Het
Lypd8	T	A	11: 58,382,814	C40S	possibly damaging	Het
Macf1	C	T	4: 123,432,434	R5092Q	probably damaging	Het
Mcm7	A	G	5: 138,168,331		probably null	Het
Micall2	G	A	5: 139,710,415	T831I	unknown	Het
Myo18b	A	T	5: 112,875,061	M155K	unknown	Het
Nckap5	T	A	1: 125,940,191	H201L	unknown	Het
Ndst2	A	T	14: 20,729,172	D333E	possibly damaging	Het
Nlgn1	A	G	3: 25,912,640		probably null	Het
Nup188	T	G	2: 30,342,385	Y1483D	probably benign	Het
Olfr1214	A	C	2: 88,987,713	L163*	probably null	Het
Olfr490	T	A	7: 108,286,319	Y269F	probably benign	Het
Olfr503	A	C	7: 108,545,457	I311L	probably benign	Het
Olfr629	T	A	7: 103,741,112	S43C	probably benign	Het
Olfr952	T	A	9: 39,426,339	H244L	probably damaging	Het
Peg3	A	C	7: 6,708,227	I1332S	possibly damaging	Het
Piezo2	T	C	18: 63,021,301	K2469R	probably damaging	Het
Pik3cg	T	C	12: 32,197,313	M804V	probably damaging	Het
Polq	A	T	16: 37,048,649	I794F	possibly damaging	Het
Rasgef1b	A	G	5: 99,222,332	V437A	probably benign	Het
Rdm1	T	A	11: 101,628,031	D21E	probably benign	Het
Ripk4	G	T	16: 97,750,111	Q219K	possibly damaging	Het
Ropn1l	T	C	15: 31,441,325	I217V		Het
Sdf2	T	C	11: 78,246,032	S13P	unknown	Het
Selenbp1	A	G	3: 94,939,768	T202A	probably benign	Het
Slfn5	T	C	11: 82,960,107	F410S	possibly damaging	Het
Srrm2	A	G	17: 23,820,906	T2175A	probably benign	Het
St6galnac3	T	C	3: 153,411,723	Y121C	possibly damaging	Het
Stat1	A	G	1: 52,145,178	N417S	probably benign	Het
Tead1	T	C	7: 112,876,171	F276L	probably damaging	Het
Teddm3	A	T	16: 21,152,987	S277R	probably benign	Het
Tmc2	A	G	2: 130,261,397		probably null	Het
Tmem156	G	A	5: 65,073,784	L248F	probably damaging	Het
Tnn	T	C	1: 160,126,416	S590G	probably benign	Het
Trmt44	A	G	5: 35,574,078		probably null	Het
Upp2	T	A	2: 58,778,010	Y238*	probably null	Het
Usp32	T	C	11: 85,040,012	T531A	probably damaging	Het
Vmn2r78	A	T	7: 86,920,223	D108V	probably benign	Het
Wdfy3	G	T	5: 101,930,964	A824E	probably benign	Het
Xylt1	T	C	7: 117,656,647	V814A	probably benign	Het
Zfy1	C	T	Y: 732,990	R281H	unknown	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9455:Adamts5	UTSW	16	85870129	missense	probably damaging	0.99
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCCTGGAAAAGCACTTCC -3'
(R):5'- ACTTCTTAGGTCGCTGGTTATAGC -3'

Sequencing Primer
(F):5'- GTGTTGGGTCTCGCCACTTAC -3'
(R):5'- GGTCGCTGGTTATAGCAATTTGAAAC -3'

Posted On

2022-02-07