Mutagenetix > Incidental Mutations

Incidental Mutation 'R7066:Adamts5'

548595

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R7066 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85862764 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 880 (V880E)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023611
AA Change: V880E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: V880E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	T	C	19: 31,927,114	V175A	probably damaging	Het
Adgrf1	T	A	17: 43,310,260	F463I	probably benign	Het
Ano1	T	A	7: 144,637,086	E249D	probably benign	Het
Aoc1	A	G	6: 48,908,619	D686G	probably damaging	Het
Cacna1d	A	T	14: 30,352,978		probably benign	Het
Cdc42ep4	A	G	11: 113,729,218	S116P	probably damaging	Het
Ces2a	T	C	8: 104,740,248	V463A	probably damaging	Het
Depdc5	A	G	5: 32,901,848	D297G	probably benign	Het
Fsip2	T	A	2: 82,990,891	V5656E	possibly damaging	Het
Gbp5	A	G	3: 142,507,729	T469A	probably benign	Het
Gm21663	C	G	5: 25,941,261		probably null	Het
Iqch	A	G	9: 63,524,745	V456A	probably benign	Het
Lpcat1	A	C	13: 73,511,381	I373L	probably benign	Het
Morc2b	C	T	17: 33,136,636	V721I	probably benign	Het
Mrgprb1	C	T	7: 48,447,676	V163M	probably benign	Het
Mtfr2	A	G	10: 20,354,226	I142V	possibly damaging	Het
Muc16	A	T	9: 18,658,021	S1067R	unknown	Het
Myh14	T	C	7: 44,630,755	S892G	possibly damaging	Het
Mylk2	C	T	2: 152,911,668		probably null	Het
Mzf1	A	T	7: 13,043,563	V638E	possibly damaging	Het
Ncoa1	C	T	12: 4,322,934	V156I	possibly damaging	Het
Nf1	A	G	11: 79,556,720	E2450G	probably damaging	Het
Olfr1048	T	C	2: 86,236,658	D52G	probably damaging	Het
Olfr1086	T	A	2: 86,677,226	T36S	possibly damaging	Het
Olfr114	T	A	17: 37,590,143	D70V	probably damaging	Het
Olfr1245	T	C	2: 89,575,703	T8A	probably damaging	Het
Olfr1313	G	A	2: 112,072,196	P129L	probably damaging	Het
Olfr389	A	G	11: 73,777,192	I45T	probably damaging	Het
Olfr794	T	C	10: 129,571,504	L283S	probably damaging	Het
Olfr969	A	G	9: 39,796,124	I250V	probably benign	Het
P4htm	T	G	9: 108,596,963	K125N	probably damaging	Het
Patj	A	G	4: 98,413,197	T240A	probably benign	Het
Pcolce2	T	C	9: 95,681,621	V220A	probably benign	Het
Pcyox1	A	T	6: 86,394,496	I136N	probably damaging	Het
Pde4b	A	G	4: 102,602,806	S395G	probably benign	Het
Peg3	C	A	7: 6,708,857	R1122L	probably damaging	Het
Plekhm1	A	G	11: 103,370,988	V922A	possibly damaging	Het
Rad51c	T	C	11: 87,402,676	N118S	possibly damaging	Het
Rb1cc1	T	A	1: 6,250,005	V1216D	possibly damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rlf	T	C	4: 121,148,787	M999V	probably benign	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,579,918		probably benign	Het
Samd7	G	C	3: 30,751,123	K18N	probably benign	Het
Sema5b	A	C	16: 35,651,312	D425A	probably benign	Het
Siglecg	A	G	7: 43,411,742	E413G	probably benign	Het
Tcaf1	A	T	6: 42,679,177	N288K	probably damaging	Het
Tdp1	A	G	12: 99,894,732	D210G	probably benign	Het
Umps	A	T	16: 33,961,733	L273*	probably null	Het
Vcan	A	T	13: 89,705,686	V385D	probably damaging	Het
Wdr59	T	C	8: 111,465,845	T676A	probably benign	Het
Zdbf2	A	G	1: 63,307,559	H1699R	probably benign	Het
Zfp27	AATCCGCTTGTGCA	AA	7: 29,895,021		probably benign	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably null
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCACCACAGCTGTATCTGC -3'
(R):5'- ACATGGGATGGGCTATTCAG -3'

Sequencing Primer
(F):5'- ACAGCTGTATCTGCGATGATC -3'
(R):5'- GCCACAAAAGAAATCCTGATCGTG -3'

Posted On

2019-05-13