Incidental Mutation 'R9527:Cntln'
ID 719304
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R9527 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84892120 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 335 (Q335R)
Ref Sequence ENSEMBL: ENSMUSP00000044138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: Q335R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: Q335R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: Q335R

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl A G 2: 127,886,284 (GRCm39) D453G probably benign Het
Aqr A C 2: 113,932,037 (GRCm39) S1443R probably benign Het
Atr T C 9: 95,767,429 (GRCm39) M1162T probably damaging Het
Bicdl1 T A 5: 115,811,188 (GRCm39) N241I possibly damaging Het
Catip A G 1: 74,401,637 (GRCm39) N38S probably benign Het
Cct6b A G 11: 82,630,447 (GRCm39) probably null Het
Clspn A T 4: 126,453,792 (GRCm39) R72* probably null Het
Col9a2 T C 4: 120,899,528 (GRCm39) probably null Het
Dip2c A G 13: 9,544,875 (GRCm39) N55D unknown Het
Dnajc5b A T 3: 19,633,248 (GRCm39) D157V probably damaging Het
Exoc6 T G 19: 37,558,987 (GRCm39) D86E probably benign Het
Fam204a A T 19: 60,208,992 (GRCm39) H87Q probably damaging Het
Fer1l4 A G 2: 155,871,617 (GRCm39) W1388R probably damaging Het
Hcn2 A T 10: 79,570,706 (GRCm39) I642F probably benign Het
Igsf9 C A 1: 172,323,244 (GRCm39) L653M probably damaging Het
Imp4 A G 1: 34,481,991 (GRCm39) E38G probably benign Het
Kirrel1 C A 3: 86,996,912 (GRCm39) E297* probably null Het
Krt82 G A 15: 101,454,558 (GRCm39) T222I probably benign Het
Lysmd1 T C 3: 95,042,156 (GRCm39) L10P probably benign Het
Mcmbp A G 7: 128,305,242 (GRCm39) S509P probably damaging Het
Mms19 A T 19: 41,952,830 (GRCm39) I93N possibly damaging Het
Mtmr7 A G 8: 41,011,345 (GRCm39) F402L possibly damaging Het
Myo1h C T 5: 114,453,098 (GRCm39) R49C Het
Scd3 T C 19: 44,226,816 (GRCm39) Y217H probably benign Het
Snx17 T C 5: 31,353,826 (GRCm39) Y205H probably damaging Het
Spag17 T A 3: 99,970,777 (GRCm39) D1320E probably damaging Het
Tasor2 A T 13: 3,635,191 (GRCm39) S539T possibly damaging Het
Xirp1 C A 9: 119,847,558 (GRCm39) V442L probably damaging Het
Xrcc5 G A 1: 72,369,091 (GRCm39) R315H probably damaging Het
Yju2b A T 8: 84,989,652 (GRCm39) C56S probably damaging Het
Zc3hav1 C A 6: 38,330,913 (GRCm39) C82F probably damaging Het
Zfp787 A G 7: 6,136,027 (GRCm39) F75L probably damaging Het
Zswim3 C T 2: 164,662,285 (GRCm39) T255I probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTTGAAAACCACAGTAGTTC -3'
(R):5'- ACATTTTCACAGTGACACAGC -3'

Sequencing Primer
(F):5'- TCTATCCCCTTAGATGAGCC -3'
(R):5'- ACACAGCAGCGTACTTTTTGG -3'
Posted On 2022-07-18