Incidental Mutation 'R6298:Cntln'
ID 508883
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 044408-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R6298 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85014998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1096 (N1096K)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000107190] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: N1097K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: N1097K

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107190
SMART Domains Protein: ENSMUSP00000102808
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:HisKA 135 191 8e-27 BLAST
low complexity region 192 213 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: N1096K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: N1096K

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Meta Mutation Damage Score 0.0615 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,539,833 (GRCm39) M733L probably benign Het
Acss3 G A 10: 106,920,717 (GRCm39) P131L probably damaging Het
Adgrv1 T A 13: 81,539,886 (GRCm39) I5678F probably benign Het
Aff1 C T 5: 103,902,586 (GRCm39) L6F possibly damaging Het
Ank3 G T 10: 69,686,006 (GRCm39) R273L probably damaging Het
Anks1b G A 10: 90,516,699 (GRCm39) G898D probably damaging Het
Anxa11 C T 14: 25,873,158 (GRCm39) P131S unknown Het
Ap4e1 T A 2: 126,889,035 (GRCm39) M500K probably benign Het
Bag3 T C 7: 128,141,922 (GRCm39) S138P probably damaging Het
Capn9 T C 8: 125,344,193 (GRCm39) V670A probably benign Het
Ccne2 T A 4: 11,199,306 (GRCm39) W236R probably damaging Het
Cdh23 A T 10: 60,262,451 (GRCm39) Y702* probably null Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Cit A T 5: 116,086,124 (GRCm39) E896V probably damaging Het
Cntnap5c T C 17: 58,411,747 (GRCm39) C544R probably damaging Het
Csf1 A T 3: 107,655,675 (GRCm39) L452Q possibly damaging Het
Cts8 T A 13: 61,397,037 (GRCm39) K294N possibly damaging Het
Dcakd T G 11: 102,890,618 (GRCm39) E56D possibly damaging Het
Dnah17 T C 11: 117,998,987 (GRCm39) I929V probably benign Het
Dnah2 G T 11: 69,382,467 (GRCm39) H1214Q probably benign Het
Dock9 T C 14: 121,872,006 (GRCm39) D536G probably damaging Het
Drc3 A G 11: 60,284,596 (GRCm39) N467S possibly damaging Het
Dysf A G 6: 84,084,118 (GRCm39) probably null Het
Ecpas T G 4: 58,877,157 (GRCm39) T93P probably damaging Het
Evpl A T 11: 116,121,748 (GRCm39) L378Q probably damaging Het
Fer1l4 A T 2: 155,866,660 (GRCm39) H1520Q probably damaging Het
Fhod1 A T 8: 106,063,780 (GRCm39) probably benign Het
Gabra1 T A 11: 42,073,205 (GRCm39) probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm14137 A G 2: 119,005,572 (GRCm39) T44A possibly damaging Het
H2bl1 T A 13: 99,120,974 (GRCm39) R17S probably benign Het
Herc2 T C 7: 55,841,013 (GRCm39) M3444T probably benign Het
Igsf5 T C 16: 96,197,648 (GRCm39) S208P possibly damaging Het
Ino80b A G 6: 83,102,066 (GRCm39) L12P possibly damaging Het
Insrr A G 3: 87,720,272 (GRCm39) D970G probably damaging Het
Iqcf4 G A 9: 106,445,874 (GRCm39) A91V probably benign Het
Itga10 A G 3: 96,564,078 (GRCm39) T911A probably benign Het
Katnip T C 7: 125,469,869 (GRCm39) V1446A probably benign Het
Klhl30 A T 1: 91,285,086 (GRCm39) D314V probably benign Het
Lpcat1 T C 13: 73,659,074 (GRCm39) V330A possibly damaging Het
Myef2l T C 3: 10,154,239 (GRCm39) I336T probably damaging Het
Nhlrc3 A T 3: 53,359,944 (GRCm39) D306E possibly damaging Het
Notum T A 11: 120,548,766 (GRCm39) I187F probably damaging Het
Nphp3 T C 9: 103,892,640 (GRCm39) L288P probably damaging Het
Ntrk2 G T 13: 59,019,570 (GRCm39) E394* probably null Het
Or6k2 T A 1: 173,979,748 (GRCm39) V222D probably benign Het
Pbld2 A G 10: 62,874,931 (GRCm39) K63E probably benign Het
Phc2 T C 4: 128,641,982 (GRCm39) M768T possibly damaging Het
Pik3c2g G A 6: 139,603,561 (GRCm39) C249Y probably damaging Het
Plod1 G A 4: 148,000,772 (GRCm39) probably benign Het
Plscr2 A T 9: 92,172,772 (GRCm39) T9S probably benign Het
Pnrc1 T A 4: 33,246,315 (GRCm39) M215L probably benign Het
Prcp G T 7: 92,577,841 (GRCm39) C370F probably damaging Het
Pter A G 2: 12,983,205 (GRCm39) N70S probably damaging Het
Ptprt G T 2: 161,395,779 (GRCm39) H1131Q probably damaging Het
Rasal2 T C 1: 157,239,432 (GRCm39) D8G possibly damaging Het
Rcn2 A C 9: 55,960,209 (GRCm39) K159Q probably benign Het
Rex2 T A 4: 147,141,972 (GRCm39) C153* probably null Het
Rps6ka2 T C 17: 7,437,766 (GRCm39) F8S possibly damaging Het
Samd9l A G 6: 3,375,383 (GRCm39) L626S probably damaging Het
Sptb A G 12: 76,667,428 (GRCm39) probably null Het
Srgap3 A T 6: 112,793,571 (GRCm39) V135D probably damaging Het
Srsf7 T C 17: 80,514,682 (GRCm39) probably benign Het
Tacc2 A G 7: 130,228,255 (GRCm39) T1647A probably benign Het
Thap12 G T 7: 98,352,612 (GRCm39) A6S probably damaging Het
Tmem33 T A 5: 67,425,894 (GRCm39) L146* probably null Het
Trip13 C A 13: 74,084,378 (GRCm39) E36* probably null Het
Vkorc1l1 T A 5: 129,971,079 (GRCm39) C23S probably damaging Het
Vmn1r20 G A 6: 57,409,112 (GRCm39) R146H probably benign Het
Vmn1r222 T A 13: 23,416,965 (GRCm39) I83F probably benign Het
Vmn2r107 A T 17: 20,576,044 (GRCm39) I125F probably benign Het
Vmn2r116 A G 17: 23,605,736 (GRCm39) D216G probably damaging Het
Vwa3a C T 7: 120,394,874 (GRCm39) T898I probably benign Het
Wdfy3 T C 5: 102,116,812 (GRCm39) D76G probably damaging Het
Wdhd1 T C 14: 47,510,579 (GRCm39) D148G possibly damaging Het
Xylt1 T C 7: 117,255,960 (GRCm39) I844T probably damaging Het
Zfp106 A T 2: 120,353,185 (GRCm39) V1535D probably damaging Het
Zfp385b A T 2: 77,244,323 (GRCm39) L315Q possibly damaging Het
Zfp458 T A 13: 67,404,870 (GRCm39) H523L probably damaging Het
Zfp712 T C 13: 67,189,393 (GRCm39) H378R probably damaging Het
Zic1 T C 9: 91,246,556 (GRCm39) Y172C probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTCTATGGTCTGGCATGC -3'
(R):5'- GCAACTAGATTGTCGTAAATCATGC -3'

Sequencing Primer
(F):5'- CTATGGTCTGGCATGCTGTATAATG -3'
(R):5'- TCCATTGTTAAAGGTAAATGCTGG -3'
Posted On 2018-04-02