Incidental Mutation 'R1681:Cntln'
ID 188483
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 039717-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R1681 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84865872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 176 (L176S)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: L176S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: L176S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102819
AA Change: L176S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070
AA Change: L176S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
coiled coil region 166 277 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: L176S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: L176S

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,117,011 (GRCm39) I247N probably damaging Het
Ankle1 G T 8: 71,860,262 (GRCm39) S260I probably benign Het
Aoc2 T C 11: 101,216,018 (GRCm39) S34P probably benign Het
Ap1m1 A C 8: 73,009,966 (GRCm39) I397L possibly damaging Het
Apba1 C A 19: 23,913,925 (GRCm39) D649E probably damaging Het
Aptx C T 4: 40,697,274 (GRCm39) V25M probably benign Het
Arhgef18 G A 8: 3,489,645 (GRCm39) G326R probably damaging Het
Atm A C 9: 53,433,455 (GRCm39) I265S possibly damaging Het
B3galt4 A T 17: 34,170,187 (GRCm39) V17E probably benign Het
Bcl7a T A 5: 123,494,086 (GRCm39) M86K possibly damaging Het
Calhm6 A G 10: 34,003,896 (GRCm39) F4L probably benign Het
Cela3a T A 4: 137,129,995 (GRCm39) probably null Het
Cep85 T A 4: 133,876,039 (GRCm39) K456* probably null Het
Ces1f C A 8: 94,002,042 (GRCm39) A29S probably benign Het
Chd9 A T 8: 91,699,763 (GRCm39) I598F probably damaging Het
Cntn3 A T 6: 102,147,629 (GRCm39) N909K probably damaging Het
Cntnap5b T C 1: 100,003,832 (GRCm39) S271P probably damaging Het
Col6a3 T A 1: 90,701,224 (GRCm39) H2564L unknown Het
Cyp2b19 C A 7: 26,462,765 (GRCm39) probably null Het
Dapk1 G T 13: 60,866,278 (GRCm39) probably null Het
Dnah7b T A 1: 46,363,872 (GRCm39) Y3497* probably null Het
Duoxa2 T C 2: 122,129,643 (GRCm39) probably null Het
Eny2 T C 15: 44,295,874 (GRCm39) W42R probably damaging Het
Epha3 A G 16: 63,416,091 (GRCm39) V635A probably damaging Het
Fam167b G C 4: 129,472,069 (GRCm39) Q34E probably benign Het
Fancm T C 12: 65,152,430 (GRCm39) M962T probably benign Het
Gimap8 T A 6: 48,633,345 (GRCm39) I388N probably benign Het
Gpaa1 A G 15: 76,215,653 (GRCm39) T22A probably benign Het
Hoxc11 T C 15: 102,863,591 (GRCm39) S211P possibly damaging Het
Hsd17b12 T C 2: 93,863,906 (GRCm39) N312S unknown Het
Idh2 T G 7: 79,748,906 (GRCm39) E125A probably damaging Het
Igdcc4 A G 9: 65,036,077 (GRCm39) Y712C probably damaging Het
Kank1 T C 19: 25,387,668 (GRCm39) V447A possibly damaging Het
Kif1b T A 4: 149,279,958 (GRCm39) probably null Het
Klc4 A T 17: 46,947,696 (GRCm39) D335E probably damaging Het
Klhl33 T A 14: 51,130,534 (GRCm39) D320V probably benign Het
Krt73 A T 15: 101,710,482 (GRCm39) M84K possibly damaging Het
Kti12 T A 4: 108,706,055 (GRCm39) I323N probably damaging Het
Kynu T C 2: 43,569,837 (GRCm39) L373P probably damaging Het
Lats1 T C 10: 7,581,678 (GRCm39) M821T probably damaging Het
Lnx1 A T 5: 74,846,071 (GRCm39) H126Q probably benign Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc4b T A 7: 44,110,601 (GRCm39) Y158N probably damaging Het
Lrrc74b C A 16: 17,377,617 (GRCm39) R87L probably damaging Het
Meig1 T C 2: 3,410,311 (GRCm39) D63G probably damaging Het
Mrpl38 G A 11: 116,029,255 (GRCm39) probably benign Het
Mtcl2 T C 2: 156,872,450 (GRCm39) T966A possibly damaging Het
Naip2 C T 13: 100,298,368 (GRCm39) G556D probably benign Het
Naip2 T C 13: 100,298,362 (GRCm39) E558G probably benign Het
Nlrp1a T A 11: 71,033,184 (GRCm39) E3D unknown Het
Nphs2 T A 1: 156,148,468 (GRCm39) D110E probably damaging Het
Nxn T A 11: 76,163,290 (GRCm39) K244N probably benign Het
Oas3 A T 5: 120,907,973 (GRCm39) F322L probably benign Het
Obscn T A 11: 58,994,151 (GRCm39) Y1577F probably damaging Het
Or10ag57 G A 2: 87,218,964 (GRCm39) R305K possibly damaging Het
Or8b47 T A 9: 38,435,413 (GRCm39) N128K probably benign Het
Or8b50 G A 9: 38,518,244 (GRCm39) G161D probably damaging Het
Or8b52 A G 9: 38,576,616 (GRCm39) Y175H probably benign Het
Or8d2 T C 9: 38,759,809 (GRCm39) M133T probably damaging Het
Panx1 T C 9: 14,919,079 (GRCm39) D260G probably benign Het
Pcdhb15 T C 18: 37,606,866 (GRCm39) Y33H probably damaging Het
Pik3ap1 C A 19: 41,296,968 (GRCm39) V461F probably damaging Het
Plpp3 G A 4: 105,066,002 (GRCm39) probably null Het
Prtn3 A T 10: 79,716,375 (GRCm39) T61S probably benign Het
Psen1 T A 12: 83,771,394 (GRCm39) Y225N probably damaging Het
Rab44 T A 17: 29,359,098 (GRCm39) S429T possibly damaging Het
Ralgapa1 T C 12: 55,809,388 (GRCm39) I462M probably benign Het
Rbfox3 T C 11: 118,396,495 (GRCm39) N105S probably damaging Het
Rbm7 A C 9: 48,401,021 (GRCm39) Y236D possibly damaging Het
Samhd1 T C 2: 156,943,652 (GRCm39) T621A probably benign Het
Samt3 C A X: 85,090,256 (GRCm39) D49E probably benign Het
Sass6 T C 3: 116,397,122 (GRCm39) V26A possibly damaging Het
Scn11a C T 9: 119,633,478 (GRCm39) M418I possibly damaging Het
Scrib T C 15: 75,936,416 (GRCm39) E480G probably damaging Het
Sec24a T G 11: 51,586,016 (GRCm39) T1071P probably damaging Het
Siglecg A C 7: 43,058,365 (GRCm39) E84A probably benign Het
Slc6a17 C T 3: 107,381,702 (GRCm39) V419I probably damaging Het
Ssr2 T C 3: 88,488,349 (GRCm39) M75T possibly damaging Het
Tbc1d22b A G 17: 29,794,151 (GRCm39) T275A possibly damaging Het
Tbx15 T A 3: 99,259,140 (GRCm39) probably null Het
Tll1 A C 8: 64,538,585 (GRCm39) L353R possibly damaging Het
Tlr4 C T 4: 66,759,342 (GRCm39) P712S probably damaging Het
Tmem145 T A 7: 25,014,159 (GRCm39) F424L possibly damaging Het
Tnrc18 T C 5: 142,759,572 (GRCm39) K755E unknown Het
Trmt44 A G 5: 35,727,321 (GRCm39) I298T probably benign Het
Vmn1r69 A G 7: 10,314,179 (GRCm39) V184A probably benign Het
Zfp84 T C 7: 29,476,825 (GRCm39) C506R probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTGGACATTTAAAGGAGCGGC -3'
(R):5'- ACCCTCACAGGCTCATTAGATGGAG -3'

Sequencing Primer
(F):5'- ggctgggagagtggtagag -3'
(R):5'- ACACCTTGTTAAGCATCTGATTG -3'
Posted On 2014-05-09