Mutagenetix > Incidental Mutation

Incidental Mutation 'R8962:Zdbf2'

682367

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R8962 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 63308003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1847 (G1847D)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

probably benign
Transcript: ENSMUST00000029025
AA Change: G1847D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: G1847D

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114132
AA Change: G1847D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: G1847D

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.4%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	T	A	9: 46,308,875	M120L	probably benign	Het
6430573F11Rik	A	G	8: 36,505,575	K60E	probably damaging	Het
Abat	A	G	16: 8,578,302	T48A	probably damaging	Het
Abca8a	A	T	11: 110,078,808	I314N	probably damaging	Het
Abr	A	T	11: 76,461,329	V108D	probably damaging	Het
Adamts17	T	G	7: 67,075,309	L162V	probably damaging	Het
Adamts6	A	T	13: 104,297,391	K109N	probably damaging	Het
Ago3	A	G	4: 126,347,802	F68S	probably damaging	Het
Aifm3	T	C	16: 17,506,336		probably null	Het
Ankrd26	T	C	6: 118,535,143	E506G	probably benign	Het
Apaf1	A	G	10: 91,067,204	L185P	probably damaging	Het
Atp8b3	G	T	10: 80,520,062	T1272K	probably benign	Het
Cars2	A	G	8: 11,537,304	V193A	probably benign	Het
Ccr8	A	T	9: 120,094,547	I243F	possibly damaging	Het
Col12a1	A	G	9: 79,631,619	V2465A	probably damaging	Het
Ctbp1	T	C	5: 33,259,272	N127S	probably benign	Het
Ddx10	A	G	9: 53,238,077	S117P	probably damaging	Het
Dgkb	T	C	12: 38,139,495		probably null	Het
Dnah11	T	A	12: 117,952,538	D3520V	probably damaging	Het
Dnah11	C	T	12: 117,954,895	D1530N	probably damaging	Het
Dock5	T	C	14: 67,757,191	T1807A	probably benign	Het
Drd3	C	T	16: 43,821,479	T386I	probably damaging	Het
Dsg1b	A	G	18: 20,409,259	N941S	probably damaging	Het
Enpp3	T	C	10: 24,820,615	T141A	probably benign	Het
Esyt1	A	T	10: 128,520,697	C360S	possibly damaging	Het
Ethe1	T	A	7: 24,606,257	V143D	probably damaging	Het
Fam170b	A	G	14: 32,835,379	D57G	probably benign	Het
Fam53c	T	C	18: 34,768,176	S49P	probably damaging	Het
Fbp1	G	A	13: 62,875,253	L77F	probably benign	Het
Gm10471	T	G	5: 26,085,747	E142A	probably benign	Het
Gm17093	A	G	14: 44,520,692	E110G		Het
Gm21976	G	T	13: 98,287,313		silent	Het
Golgb1	T	C	16: 36,913,616	I1075T	probably damaging	Het
Grip2	T	C	6: 91,777,410	D628G	probably damaging	Het
Gtpbp1	G	T	15: 79,717,728	L557F	probably benign	Het
Ighv12-3	A	T	12: 114,366,584	F97Y	probably benign	Het
Itga8	T	C	2: 12,191,234	H635R	possibly damaging	Het
Itgb7	A	G	15: 102,218,602	L466S	probably damaging	Het
Klc2	T	C	19: 5,111,836	D277G	probably benign	Het
Ktn1	A	G	14: 47,663,791	E2G	probably damaging	Het
Lcmt1	T	A	7: 123,401,446	Y68N	probably damaging	Het
March10	G	T	11: 105,389,989	S490*	probably null	Het
Mterf1b	A	T	5: 4,196,437	Y26F	probably benign	Het
Myo18b	T	A	5: 112,858,480	I855F	probably benign	Het
Nek4	G	A	14: 30,953,958	M83I	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nos1	T	C	5: 117,879,340	V256A	probably benign	Het
Nr1h2	T	C	7: 44,552,039	T50A	probably benign	Het
Olfr296-ps1	T	A	7: 86,562,109	*126K	probably null	Het
Olfr732	A	C	14: 50,281,359	M298R	possibly damaging	Het
Ovol2	G	C	2: 144,305,914	R172G	probably damaging	Het
Parp14	A	G	16: 35,856,817	I927T	probably damaging	Het
Pcdhga7	T	A	18: 37,715,826	H295Q	probably benign	Het
Pkhd1l1	C	T	15: 44,536,895	T2145I	probably damaging	Het
Plekhs1	C	T	19: 56,473,248	T139I	possibly damaging	Het
Rab11fip3	T	A	17: 26,012,033	D746V	probably damaging	Het
Rnf214	A	C	9: 45,898,430		probably null	Het
Rtn4ip1	A	T	10: 43,946,419		probably null	Het
S1pr1	T	C	3: 115,711,920	R342G		Het
Serpina1f	T	C	12: 103,689,872	S366G	probably benign	Het
Sestd1	A	T	2: 77,212,364	M282K	probably benign	Het
Siglecf	T	G	7: 43,351,716	V36G	probably damaging	Het
Slc1a1	T	C	19: 28,909,469	V410A	probably damaging	Het
Slc38a4	C	A	15: 97,019,803	D14Y	probably benign	Het
Slk	C	T	19: 47,622,309	T806M	probably damaging	Het
Slurp2	C	A	15: 74,743,400	V48F	possibly damaging	Het
Socs1	A	G	16: 10,784,778	S32P	possibly damaging	Het
Son	T	C	16: 91,658,169	V1268A	possibly damaging	Het
Sp7	C	A	15: 102,366,445		probably benign	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Tet2	T	C	3: 133,488,043	N210S	probably benign	Het
Tkfc	T	C	19: 10,593,336	D492G	probably damaging	Het
Tmc7	G	A	7: 118,561,005	P203L	probably benign	Het
Tshz2	C	A	2: 169,884,604	F373L	probably damaging	Het
Ttc29	T	A	8: 78,315,707	L307Q	probably damaging	Het
Tubd1	G	A	11: 86,548,833	M1I	probably null	Het
Vmn1r62	T	A	7: 5,675,602	M94K	probably damaging	Het
Vmn2r125	T	C	4: 156,350,891	I188T	possibly damaging	Het
Vmn2r5	T	C	3: 64,491,143	D805G	probably damaging	Het
Vmn2r6	A	T	3: 64,556,155	D419E	probably damaging	Het
Vps39	A	T	2: 120,344,206	Y98*	probably null	Het
Wisp2	C	T	2: 163,825,240	R54*	probably null	Het
Zdhhc6	T	C	19: 55,298,807	E407G	probably benign	Het
Zfp407	A	G	18: 84,558,932	I1352T	probably damaging	Het
Zfp607a	A	G	7: 27,879,361	K619E	possibly damaging	Het
Zfp811	A	T	17: 32,798,648	N139K	probably benign	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCAGGGTAAGAAAGTGACTTTTG -3'
(R):5'- AAGCCCCTCTGCTAAGGAAC -3'

Sequencing Primer
(F):5'- AGGGTAAGAAAGTGACTTTTGACTTG -3'
(R):5'- CTGCTAAGGAACAAGACTGTTTACC -3'

Posted On

2021-08-31