Mutagenetix > Incidental Mutation

Incidental Mutation 'R4041:Usp32'

313890

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

MMRRC Submission

040966-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4041 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85017739 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1047 (V1047A)

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075]

AlphaFold

F8VPZ3

Predicted Effect

probably benign
Transcript: ENSMUST00000000821

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108075
AA Change: V1047A

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: V1047A

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Meta Mutation Damage Score

0.0737

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

100% (29/29)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atf5	T	C	7: 44,813,497	T68A	possibly damaging	Het
Cage1	A	G	13: 38,019,177	L637P	possibly damaging	Het
Cfl1	T	C	19: 5,492,528	I12T	probably benign	Het
Clcn1	A	G	6: 42,309,968	E653G	probably damaging	Het
Cntnap5a	C	A	1: 116,184,399	P473Q	probably benign	Het
Dnah7b	T	C	1: 46,081,495	S91P	probably benign	Het
Dusp27	T	C	1: 166,100,111	D644G	probably benign	Het
Fcgbp	A	G	7: 28,113,979	Q2313R	probably benign	Het
Gpc5	A	T	14: 115,133,216	Q151L	probably damaging	Het
Hexim1	A	G	11: 103,117,106	E62G	probably benign	Het
Ifna13	A	G	4: 88,643,991	F132S	probably benign	Het
Irgm2	A	G	11: 58,220,130	M228V	probably benign	Het
Klhl41	A	G	2: 69,670,710	M172V	probably benign	Het
Klk1	A	T	7: 44,229,562	N260I	probably damaging	Het
Krit1	G	C	5: 3,809,642	R110P	probably damaging	Het
Krt7	T	A	15: 101,423,280		probably null	Het
Lrrn4cl	T	A	19: 8,852,104	Y149N	probably damaging	Het
Ltbp3	G	T	19: 5,751,871	C739F	possibly damaging	Het
Mbnl2	C	T	14: 120,389,074	H239Y	probably damaging	Het
Obscn	G	A	11: 59,051,531	R4942*	probably null	Het
Olfr1344	T	C	7: 6,440,689	L263P	probably damaging	Het
R3hcc1	A	G	14: 69,706,662	S45P	probably damaging	Het
Ryr1	A	T	7: 29,085,931	H1778Q	possibly damaging	Het
Scyl2	T	A	10: 89,650,052	K558N	probably damaging	Het
Shank1	G	A	7: 44,342,162	V677M	unknown	Het
Slc39a5	T	C	10: 128,396,468	M488V	possibly damaging	Het
Styk1	A	T	6: 131,312,917		probably null	Het
Wnt3a	G	T	11: 59,249,644	H349N	probably damaging	Het
Zbtb39	T	C	10: 127,743,554	C666R	probably damaging	Het
Zfp420	T	C	7: 29,876,002	M549T	probably benign	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
BB010:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
BB020:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7765:Usp32	UTSW	11	84994408	missense	probably damaging	1.00
R7933:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
R7973:Usp32	UTSW	11	85022808	missense	probably damaging	0.99
R7989:Usp32	UTSW	11	85034300	missense
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
R8292:Usp32	UTSW	11	85077401	missense	probably damaging	0.99
R8305:Usp32	UTSW	11	85032185	missense	possibly damaging	0.83
R8548:Usp32	UTSW	11	85017827	missense	possibly damaging	0.52
R8924:Usp32	UTSW	11	85025544	missense	probably damaging	0.98
R9002:Usp32	UTSW	11	85053951	missense	probably damaging	0.96
R9145:Usp32	UTSW	11	85022292	missense	probably damaging	1.00
R9209:Usp32	UTSW	11	85040012	missense	probably damaging	0.98
R9211:Usp32	UTSW	11	85022733	missense	probably damaging	1.00
R9296:Usp32	UTSW	11	85017652	missense	probably damaging	1.00
R9310:Usp32	UTSW	11	85051202	missense	probably benign	0.29
R9417:Usp32	UTSW	11	84994543	missense	probably damaging	1.00
R9514:Usp32	UTSW	11	85022734	missense	probably damaging	0.99
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCATTTCACCAATGAGGGC -3'
(R):5'- CTTTGCCCTTTAGTCATAAGCATGAG -3'

Sequencing Primer
(F):5'- CATTTCACCAATGAGGGCTGACATG -3'
(R):5'- GTCAACCCTGTCAATGTTCAAG -3'

Posted On

2015-04-30