Incidental Mutation 'R5659:Usp32'
ID 443998
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
MMRRC Submission 043303-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5659 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85077414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 141 (V141A)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect possibly damaging
Transcript: ENSMUST00000108075
AA Change: V141A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: V141A

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173271
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T C 18: 36,561,050 S105P probably damaging Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Ap3b2 T A 7: 81,476,752 I367F probably damaging Het
Apaf1 A T 10: 91,062,153 C247* probably null Het
Aqp8 G A 7: 123,466,666 W228* probably null Het
Arhgap32 T A 9: 32,181,960 V178D probably damaging Het
Atp10b T A 11: 43,245,425 W1127R probably damaging Het
Bcl6 A T 16: 23,968,409 C580* probably null Het
Brd1 T C 15: 88,713,381 T568A probably benign Het
Brsk1 C T 7: 4,715,372 P665L possibly damaging Het
Cblc A G 7: 19,792,932 L125P probably damaging Het
Ccdc87 T C 19: 4,840,850 S457P probably damaging Het
Cxcr5 C T 9: 44,513,393 M322I probably benign Het
Cyb5r4 T A 9: 87,055,828 F300Y probably benign Het
Cyp3a25 T C 5: 145,991,546 T230A possibly damaging Het
Dhx9 A G 1: 153,471,735 V409A probably damaging Het
Dnah7b A G 1: 46,352,849 D3790G probably damaging Het
Gin1 A G 1: 97,775,532 T27A possibly damaging Het
Gipc1 A T 8: 83,664,126 M287L probably benign Het
Kat6a T A 8: 22,938,160 L1177* probably null Het
Klhl20 A G 1: 161,090,470 V82A probably damaging Het
Kmt2e T C 5: 23,497,807 I995T probably damaging Het
Lpin1 A T 12: 16,540,989 V814E probably damaging Het
Luzp1 T A 4: 136,542,476 V670D probably damaging Het
Lyst C A 13: 13,634,627 A294E possibly damaging Het
Olfr267 A T 4: 58,785,672 F17I probably damaging Het
Olfr3 A T 2: 36,812,954 I46N probably damaging Het
Olfr922 C T 9: 38,815,776 T91I probably benign Het
Olr1 T A 6: 129,500,029 E91V probably damaging Het
Pam T C 1: 97,842,299 Y476C probably damaging Het
Pcdhac1 T C 18: 37,092,417 L761P probably damaging Het
Phf21b C T 15: 84,793,900 W300* probably null Het
Pld2 T C 11: 70,557,561 *945Q probably null Het
Ppp1r37 C T 7: 19,535,523 V145M probably damaging Het
Rasgrf1 T A 9: 89,984,289 N593K probably damaging Het
Rhot1 T G 11: 80,250,355 probably null Het
Rmnd1 A T 10: 4,427,382 M99K probably benign Het
Ros1 G A 10: 52,143,386 T697I possibly damaging Het
Scgb1b10 G T 7: 32,100,878 A4S probably benign Het
Shc3 T C 13: 51,516,594 Y39C probably damaging Het
Slc25a23 A G 17: 57,045,500 probably benign Het
Slc5a8 C T 10: 88,919,428 L466F possibly damaging Het
Sqor G A 2: 122,787,603 C127Y probably benign Het
Sv2a G C 3: 96,190,303 W467S possibly damaging Het
Togaram2 G T 17: 71,687,672 D39Y probably damaging Het
Tspan11 T A 6: 127,938,277 probably null Het
Zbtb38 T C 9: 96,687,420 H537R probably damaging Het
Zfat T C 15: 68,119,013 Y1008C probably damaging Het
Zfp637 G A 6: 117,843,330 G3E probably damaging Het
Zfp788 T A 7: 41,650,116 Y673* probably null Het
Zhx2 T C 15: 57,822,308 S358P probably benign Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAGCATCTCACTGATTATTTACTGG -3'
(R):5'- GGCAATTGACTGCTTTAACAAATTG -3'

Sequencing Primer
(F):5'- TCAGGCAAATTATTAAAGGTGAACG -3'
(R):5'- CTGAAATGCAGCTGTTTTGTTTTTC -3'
Posted On 2016-11-09