Incidental Mutation 'R4506:Abcc5'
ID 332034
Institutional Source Beutler Lab
Gene Symbol Abcc5
Ensembl Gene ENSMUSG00000022822
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms 2900011L11Rik, Abcc5a, Mrp5, Abcc5b
MMRRC Submission 041584-MU
Accession Numbers

Ncbi RefSeq: NM_013790.2, NM_176839.1; MGI:1351644

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4506 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 20331303-20426394 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20333695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1367 (I1367N)
Ref Sequence ENSEMBL: ENSMUSP00000111209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079158] [ENSMUST00000115547]
AlphaFold Q9R1X5
Predicted Effect probably damaging
Transcript: ENSMUST00000079158
AA Change: I1367N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: I1367N

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1142 9.3e-36 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115547
AA Change: I1367N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: I1367N

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 2e-17 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1146 6.5e-30 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134413
Meta Mutation Damage Score 0.8642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (42/43)
MGI Phenotype Strain: 3794119
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]
Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,261 P137T probably damaging Het
Ace T A 11: 105,976,666 L152Q probably damaging Het
Adam19 G A 11: 46,118,444 D232N possibly damaging Het
Anapc4 A T 5: 52,835,730 N61I possibly damaging Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Atr T A 9: 95,865,237 C191S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cnot6l A T 5: 96,086,174 V326E possibly damaging Het
Fcer2a A T 8: 3,688,603 probably null Het
Fgfr3 A G 5: 33,729,999 T221A probably damaging Het
Gm6632 C T 5: 59,054,478 noncoding transcript Het
Gm8909 A T 17: 36,161,480 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ip6k3 A T 17: 27,145,180 L298Q possibly damaging Het
Itpr1 A G 6: 108,432,686 D1727G probably damaging Het
Kdm2b T C 5: 122,888,625 T589A possibly damaging Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Map3k13 A G 16: 21,922,178 S752G probably benign Het
Mvb12a G T 8: 71,543,459 A86S probably benign Het
Nktr T A 9: 121,748,883 probably benign Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr393 A T 11: 73,847,695 C143* probably null Het
Parp4 T A 14: 56,652,304 N1847K unknown Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc7a5 A T 8: 121,887,495 probably null Het
Slc7a9 A T 7: 35,453,420 T88S probably damaging Het
Tbrg1 T A 9: 37,654,395 E87V probably damaging Het
Tnfsf4 T C 1: 161,417,174 S145P probably damaging Het
Tomm34 C A 2: 164,054,372 probably null Het
Trpv3 A G 11: 73,295,324 N647S probably benign Het
Upf1 G A 8: 70,337,566 R637C probably damaging Het
Vmn2r23 A T 6: 123,702,925 Q35H probably damaging Het
Wdtc1 C T 4: 133,308,819 V137M probably damaging Het
Zfp276 G A 8: 123,264,927 probably null Het
Zfp90 C T 8: 106,424,864 P403L possibly damaging Het
Other mutations in Abcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Abcc5 APN 16 20422357 missense probably benign 0.01
IGL00928:Abcc5 APN 16 20398970 unclassified probably benign
IGL01350:Abcc5 APN 16 20368458 missense probably benign 0.00
IGL01774:Abcc5 APN 16 20378457 missense probably damaging 1.00
IGL01934:Abcc5 APN 16 20422441 utr 5 prime probably benign
IGL02413:Abcc5 APN 16 20422437 utr 5 prime probably benign
IGL02426:Abcc5 APN 16 20338925 missense probably damaging 0.98
IGL02797:Abcc5 APN 16 20368464 missense probably benign 0.06
IGL02938:Abcc5 APN 16 20362229 missense possibly damaging 0.64
IGL03367:Abcc5 APN 16 20392811 utr 3 prime probably benign
IGL03411:Abcc5 APN 16 20399560 missense probably damaging 0.97
PIT4508001:Abcc5 UTSW 16 20357378 missense probably damaging 0.97
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0220:Abcc5 UTSW 16 20369102 missense probably benign
R0281:Abcc5 UTSW 16 20422400 missense probably damaging 1.00
R0401:Abcc5 UTSW 16 20376558 missense probably benign 0.09
R0448:Abcc5 UTSW 16 20399937 missense probably damaging 1.00
R0477:Abcc5 UTSW 16 20368569 missense possibly damaging 0.51
R0477:Abcc5 UTSW 16 20398885 missense probably damaging 0.96
R0601:Abcc5 UTSW 16 20404559 splice site probably benign
R0648:Abcc5 UTSW 16 20365882 missense possibly damaging 0.90
R0709:Abcc5 UTSW 16 20376592 missense possibly damaging 0.91
R1144:Abcc5 UTSW 16 20422438 utr 5 prime probably benign
R1552:Abcc5 UTSW 16 20398867 missense probably damaging 0.99
R1625:Abcc5 UTSW 16 20365817 missense probably damaging 0.99
R1748:Abcc5 UTSW 16 20333588 missense probably benign 0.01
R1789:Abcc5 UTSW 16 20365951 missense probably damaging 1.00
R1801:Abcc5 UTSW 16 20338887 missense probably benign 0.43
R1909:Abcc5 UTSW 16 20376509 critical splice donor site probably null
R2046:Abcc5 UTSW 16 20399817 missense possibly damaging 0.90
R2203:Abcc5 UTSW 16 20405882 missense possibly damaging 0.91
R3031:Abcc5 UTSW 16 20375113 missense probably damaging 0.99
R3417:Abcc5 UTSW 16 20405552 splice site probably benign
R3708:Abcc5 UTSW 16 20372180 missense probably benign 0.30
R3731:Abcc5 UTSW 16 20398934 nonsense probably null
R3829:Abcc5 UTSW 16 20365865 missense probably benign 0.00
R3847:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3850:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3955:Abcc5 UTSW 16 20405543 missense probably damaging 0.97
R4072:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4432:Abcc5 UTSW 16 20368187 splice site probably null
R4433:Abcc5 UTSW 16 20368187 splice site probably null
R4505:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4715:Abcc5 UTSW 16 20398876 missense probably damaging 1.00
R4739:Abcc5 UTSW 16 20399626 missense probably damaging 1.00
R4866:Abcc5 UTSW 16 20422432 start codon destroyed probably null 1.00
R4905:Abcc5 UTSW 16 20399928 missense probably damaging 1.00
R4907:Abcc5 UTSW 16 20376546 missense possibly damaging 0.86
R5088:Abcc5 UTSW 16 20376662 missense probably damaging 1.00
R5232:Abcc5 UTSW 16 20338922 missense probably damaging 0.96
R5559:Abcc5 UTSW 16 20338886 missense probably damaging 1.00
R5647:Abcc5 UTSW 16 20399847 missense probably damaging 1.00
R5861:Abcc5 UTSW 16 20399894 missense probably damaging 1.00
R6190:Abcc5 UTSW 16 20392779 missense probably benign 0.02
R6213:Abcc5 UTSW 16 20400012 missense probably damaging 1.00
R6511:Abcc5 UTSW 16 20376594 missense probably damaging 0.99
R6732:Abcc5 UTSW 16 20404684 missense probably benign 0.01
R6815:Abcc5 UTSW 16 20333630 missense probably damaging 1.00
R6913:Abcc5 UTSW 16 20378744 missense possibly damaging 0.73
R6945:Abcc5 UTSW 16 20400009 missense probably benign
R7167:Abcc5 UTSW 16 20405501 missense possibly damaging 0.70
R7276:Abcc5 UTSW 16 20376508 splice site probably null
R7318:Abcc5 UTSW 16 20392543 missense probably benign 0.01
R7380:Abcc5 UTSW 16 20397034 missense possibly damaging 0.84
R7419:Abcc5 UTSW 16 20422423 missense possibly damaging 0.57
R7451:Abcc5 UTSW 16 20375070 missense probably damaging 1.00
R7475:Abcc5 UTSW 16 20399989 missense probably benign 0.04
R7567:Abcc5 UTSW 16 20405510 missense probably damaging 1.00
R7601:Abcc5 UTSW 16 20375132 nonsense probably null
R7623:Abcc5 UTSW 16 20344696 missense possibly damaging 0.95
R7682:Abcc5 UTSW 16 20368053 missense probably damaging 1.00
R8128:Abcc5 UTSW 16 20365723 missense probably damaging 0.98
R8327:Abcc5 UTSW 16 20422318 missense probably benign 0.00
R8518:Abcc5 UTSW 16 20404648 missense possibly damaging 0.80
R8678:Abcc5 UTSW 16 20365935 missense probably benign 0.31
R8679:Abcc5 UTSW 16 20333729 missense possibly damaging 0.89
R9206:Abcc5 UTSW 16 20389389 missense probably benign 0.00
R9254:Abcc5 UTSW 16 20333687 missense probably damaging 1.00
R9379:Abcc5 UTSW 16 20333687 missense probably damaging 1.00
X0022:Abcc5 UTSW 16 20392587 missense probably damaging 1.00
X0053:Abcc5 UTSW 16 20364042 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGCTGCTTGGTGAATGCC -3'
(R):5'- TCACGTCCATGTGAAACAGTAC -3'

Sequencing Primer
(F):5'- TGAAGATGACAGGTAGCCCCTC -3'
(R):5'- GTCCATGTGAAACAGTACATCGTAC -3'
Posted On 2015-07-21