Mutagenetix > Incidental Mutations

Incidental Mutation 'R4516:Cdk5rap2'

332902

Institutional Source

Beutler Lab

Gene Symbol

Cdk5rap2

Ensembl Gene

ENSMUSG00000039298

Gene Name

CDK5 regulatory subunit associated protein 2

Synonyms

2900018K03Rik, an

MMRRC Submission

041760-MU

Accession Numbers

Genbank: NM_145990.3

Is this an essential gene?

Possibly non essential (E-score: 0.439) question?

Stock #

R4516 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70216856-70410443 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 70276715 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]

Predicted Effect

probably benign
Transcript: ENSMUST00000076541

Predicted Effect

probably null
Transcript: ENSMUST00000144099

SMART Domains

Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298

Domain	Start	End	E-Value	Type
Pfam:Cnn_1N	58	130	3.6e-26	PFAM
coiled coil region	210	345	N/A	INTRINSIC
low complexity region	368	381	N/A	INTRINSIC
coiled coil region	388	462	N/A	INTRINSIC
coiled coil region	569	616	N/A	INTRINSIC
low complexity region	761	776	N/A	INTRINSIC
low complexity region	791	800	N/A	INTRINSIC
coiled coil region	960	1001	N/A	INTRINSIC
coiled coil region	1112	1140	N/A	INTRINSIC
coiled coil region	1200	1237	N/A	INTRINSIC
Blast:BRLZ	1479	1535	6e-13	BLAST
low complexity region	1548	1565	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
low complexity region	1700	1711	N/A	INTRINSIC
low complexity region	1811	1822	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.6%
20x: 92.9%

Validation Efficiency

86% (51/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,517,200		probably benign	Het
4930452B06Rik	A	T	14: 8,536,609	D199E	probably damaging	Het
4932438A13Rik	T	C	3: 36,895,311	S369P	possibly damaging	Het
Bean1	T	C	8: 104,215,154	S211P	probably damaging	Het
Camta1	A	G	4: 151,144,720	S552P	possibly damaging	Het
Cdh11	T	C	8: 102,673,962	T125A	possibly damaging	Het
Cenpc1	A	G	5: 86,047,587	S108P	possibly damaging	Het
Cfap44	T	A	16: 44,473,864	Y224*	probably null	Het
Cfap46	G	A	7: 139,660,082		probably benign	Het
Cntrl	G	A	2: 35,127,981	V468I	probably benign	Het
Col6a6	C	T	9: 105,698,949	V2071I	possibly damaging	Het
Coq7	A	T	7: 118,509,907	L306Q	unknown	Het
D7Ertd443e	C	G	7: 134,293,328	Q591H	probably damaging	Het
Dchs1	C	T	7: 105,754,852	V2828M	probably damaging	Het
Dzank1	T	A	2: 144,510,122		probably benign	Het
Elmo1	C	T	13: 20,282,914	T235I	probably benign	Het
Elp3	A	T	14: 65,547,877	F492I	possibly damaging	Het
Espl1	A	G	15: 102,323,236	S90G	probably benign	Het
Fbxl20	T	C	11: 98,095,235		probably benign	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gm16286	G	A	18: 80,211,576	M28I	probably benign	Het
Got1	T	C	19: 43,504,841	Y243C	probably damaging	Het
Hipk1	G	T	3: 103,750,372	H799N	probably damaging	Het
Kif21a	A	T	15: 90,971,142	M673K	probably benign	Het
Lama3	T	A	18: 12,495,358	D1502E	probably damaging	Het
Limk1	A	G	5: 134,676,786		probably benign	Het
Myo5b	A	G	18: 74,625,674	Y242C	probably damaging	Het
Ncbp1	T	C	4: 46,157,824	V354A	probably damaging	Het
Ncoa2	T	C	1: 13,146,906	D1380G	probably damaging	Het
Ntng1	A	G	3: 109,935,013	I148T	probably damaging	Het
Oas1d	A	T	5: 120,919,170	T280S	probably damaging	Het
Olfr1229	T	A	2: 89,282,843	M118L	probably benign	Het
Olfr389	C	T	11: 73,777,040	G96S	probably benign	Het
Pax7	T	G	4: 139,780,793	D307A	probably benign	Het
Pdxdc1	G	A	16: 13,838,346	Q621*	probably null	Het
Rab29	A	T	1: 131,867,731	Y27F	possibly damaging	Het
Rab3gap2	G	A	1: 185,267,068	V991I	probably benign	Het
Ric1	A	G	19: 29,570,765	T278A	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc47a1	T	C	11: 61,344,513	H498R	probably benign	Het
Tas2r116	T	C	6: 132,856,150	L238P	probably damaging	Het
Tigd5	A	T	15: 75,910,515	R252*	probably null	Het
Tlr6	A	G	5: 64,954,904	F220S	possibly damaging	Het
Tmem106b	C	T	6: 13,075,099	T95I	probably damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn1r174	A	G	7: 23,754,343	I145V	probably benign	Het
Vps26a	T	C	10: 62,468,345	M116V	probably damaging	Het

Other mutations in Cdk5rap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Cdk5rap2	APN	4	70403472	critical splice donor site	probably null
IGL01305:Cdk5rap2	APN	4	70380235	missense	possibly damaging	0.52
IGL01987:Cdk5rap2	APN	4	70302082	critical splice donor site	probably null
IGL02213:Cdk5rap2	APN	4	70317602	splice site	probably benign
IGL02732:Cdk5rap2	APN	4	70266665	nonsense	probably null
IGL03063:Cdk5rap2	APN	4	70354877	critical splice acceptor site	probably null
IGL03244:Cdk5rap2	APN	4	70281435	missense	probably benign	0.19
ANU22:Cdk5rap2	UTSW	4	70380235	missense	possibly damaging	0.52
F5426:Cdk5rap2	UTSW	4	70254803	missense	probably benign
R0010:Cdk5rap2	UTSW	4	70243459	missense	probably benign	0.01
R0010:Cdk5rap2	UTSW	4	70243459	missense	probably benign	0.01
R0044:Cdk5rap2	UTSW	4	70360901	missense	probably damaging	1.00
R0044:Cdk5rap2	UTSW	4	70360901	missense	probably damaging	1.00
R0482:Cdk5rap2	UTSW	4	70410269	start gained	probably benign
R0548:Cdk5rap2	UTSW	4	70349142	critical splice donor site	probably null
R0594:Cdk5rap2	UTSW	4	70354813	missense	probably damaging	0.98
R0737:Cdk5rap2	UTSW	4	70337375	missense	probably benign	0.01
R0788:Cdk5rap2	UTSW	4	70307231	missense	possibly damaging	0.90
R0960:Cdk5rap2	UTSW	4	70243508	missense	probably benign	0.03
R1682:Cdk5rap2	UTSW	4	70302150	missense	possibly damaging	0.92
R1727:Cdk5rap2	UTSW	4	70272679	missense	probably benign
R1727:Cdk5rap2	UTSW	4	70289972	missense	possibly damaging	0.70
R1768:Cdk5rap2	UTSW	4	70307233	missense	probably benign	0.09
R1903:Cdk5rap2	UTSW	4	70403554	splice site	probably null
R2270:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2271:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2272:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2364:Cdk5rap2	UTSW	4	70360809	critical splice donor site	probably null
R2763:Cdk5rap2	UTSW	4	70281271	missense	probably benign
R2893:Cdk5rap2	UTSW	4	70289873	missense	probably benign
R2894:Cdk5rap2	UTSW	4	70289873	missense	probably benign
R2958:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2959:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2961:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2962:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2963:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R3522:Cdk5rap2	UTSW	4	70250410	missense	probably damaging	1.00
R3725:Cdk5rap2	UTSW	4	70235437	missense	possibly damaging	0.89
R3726:Cdk5rap2	UTSW	4	70235437	missense	possibly damaging	0.89
R3876:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R3919:Cdk5rap2	UTSW	4	70380223	missense	possibly damaging	0.50
R4025:Cdk5rap2	UTSW	4	70250387	missense	probably damaging	0.98
R4324:Cdk5rap2	UTSW	4	70353614	missense	probably damaging	1.00
R4485:Cdk5rap2	UTSW	4	70239283	critical splice donor site	probably null
R4556:Cdk5rap2	UTSW	4	70239312	missense	probably damaging	0.97
R4560:Cdk5rap2	UTSW	4	70315331	missense	probably benign	0.03
R4584:Cdk5rap2	UTSW	4	70266760	missense	probably damaging	1.00
R4620:Cdk5rap2	UTSW	4	70266706	missense	probably benign	0.00
R4639:Cdk5rap2	UTSW	4	70302176	missense	probably damaging	0.97
R4755:Cdk5rap2	UTSW	4	70238425	missense	probably damaging	1.00
R4947:Cdk5rap2	UTSW	4	70228592	splice site	probably null
R5116:Cdk5rap2	UTSW	4	70307238	missense	possibly damaging	0.67
R5449:Cdk5rap2	UTSW	4	70276651	missense	probably benign	0.00
R5643:Cdk5rap2	UTSW	4	70266733	missense	probably damaging	0.99
R5899:Cdk5rap2	UTSW	4	70243593	splice site	probably benign
R6177:Cdk5rap2	UTSW	4	70281482	missense	probably damaging	0.99
R6254:Cdk5rap2	UTSW	4	70364032	missense	probably damaging	1.00
R6326:Cdk5rap2	UTSW	4	70235454	missense	probably damaging	1.00
R6335:Cdk5rap2	UTSW	4	70266612	missense	possibly damaging	0.79
R6534:Cdk5rap2	UTSW	4	70354813	missense	probably damaging	0.98
R6857:Cdk5rap2	UTSW	4	70245396	nonsense	probably null
R6959:Cdk5rap2	UTSW	4	70360669	splice site	probably null
R7104:Cdk5rap2	UTSW	4	70349156	missense	probably benign	0.00
R7145:Cdk5rap2	UTSW	4	70238231	missense	probably benign	0.13
R7223:Cdk5rap2	UTSW	4	70235447	missense	probably benign	0.02
R7234:Cdk5rap2	UTSW	4	70376787	splice site	probably null
R7240:Cdk5rap2	UTSW	4	70291908	missense	probably damaging	1.00
R7247:Cdk5rap2	UTSW	4	70337429	missense	probably damaging	1.00
R7382:Cdk5rap2	UTSW	4	70290025	missense	probably benign	0.19
R7413:Cdk5rap2	UTSW	4	70254735	missense	probably damaging	1.00
R7576:Cdk5rap2	UTSW	4	70266872	missense	probably benign	0.01
R8236:Cdk5rap2	UTSW	4	70242485	missense	probably benign
R8434:Cdk5rap2	UTSW	4	70364020	missense	probably benign	0.00
Z1176:Cdk5rap2	UTSW	4	70266743	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCTCTGCCAGAATTAGCTTC -3'
(R):5'- GGAAGACTCTTGACTGTCGG -3'

Sequencing Primer
(F):5'- CTGCCAGAATTAGCTTCTCATGGAG -3'
(R):5'- AAGACTCTTGACTGTCGGTGTGTATG -3'

Posted On

2015-08-18