Incidental Mutation 'R5948:Ttc41'
ID 472285
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
MMRRC Submission 043244-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R5948 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86713224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 94 (L94P)
Ref Sequence ENSEMBL: ENSMUSP00000151920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000217747] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061458
AA Change: L94P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937
AA Change: L94P

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Blast:AAA 336 401 9e-8 BLAST
SCOP:d1jpna2 338 370 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075632
AA Change: L94P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: L94P

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217747
AA Change: L94P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219108
AA Change: L94P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 T C 3: 37,083,355 probably null Het
Adam8 G T 7: 139,987,884 D341E probably benign Het
Ankrd6 T C 4: 32,817,075 T351A possibly damaging Het
Ccdc150 T C 1: 54,277,714 S251P possibly damaging Het
Cfh T C 1: 140,108,808 N629S probably damaging Het
Col4a2 T C 8: 11,420,600 S453P probably benign Het
Csf2 T C 11: 54,247,688 D109G probably benign Het
Dapk1 C A 13: 60,729,395 H483N probably damaging Het
Dnah7c T G 1: 46,672,497 I2628R probably benign Het
Dsp T C 13: 38,195,401 Y2041H possibly damaging Het
Dusp10 A G 1: 184,068,876 N280S probably benign Het
Efhc1 T A 1: 20,972,828 Y324N probably damaging Het
Epsti1 T C 14: 77,939,890 L170P probably damaging Het
Fbn2 C T 18: 58,037,049 G2217R probably damaging Het
Fryl A G 5: 73,097,372 probably null Het
Mrpl39 T C 16: 84,725,153 N244D probably benign Het
Nptxr C T 15: 79,789,841 A445T probably benign Het
Olfr344 A G 2: 36,569,351 Y251C probably damaging Het
Otud3 A G 4: 138,897,614 Y259H probably benign Het
Parvb G A 15: 84,303,461 V257M probably damaging Het
Piezo1 T C 8: 122,483,347 E2258G probably benign Het
Prpf8 A G 11: 75,509,189 E2303G possibly damaging Het
Psmc6 A G 14: 45,334,657 D88G probably benign Het
Rbbp6 C T 7: 122,997,628 T701I probably damaging Het
Rtl1 T A 12: 109,590,599 D1602V possibly damaging Het
Rubcnl T C 14: 75,047,616 L525P probably damaging Het
Sbf2 T C 7: 110,489,285 D73G probably damaging Het
Sh3tc2 T A 18: 62,013,105 M1185K probably damaging Het
Shank2 A G 7: 144,407,223 K469E probably damaging Het
Ttf1 G A 2: 29,073,920 A603T possibly damaging Het
Usp9y A T Y: 1,324,996 H1686Q possibly damaging Het
Vps37a A G 8: 40,540,711 E249G possibly damaging Het
Zfp273 A G 13: 67,825,799 I316V probably benign Het
Zfp600 T A 4: 146,195,075 N104K probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTTAAAGCGCCAGAAACCC -3'
(R):5'- GGAGTCTTGAGAACCCAAGG -3'

Sequencing Primer
(F):5'- TTTCAAGAAGAGAGAGACTTTTTGGC -3'
(R):5'- GGTAACCATTTTTGGCAGCAATG -3'
Posted On 2017-03-31