Incidental Mutation 'R6489:Dsg4'
ID522702
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R6489 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20471363 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 962 (N962K)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019426
AA Change: N962K

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: N962K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.3%
  • 20x: 90.6%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,010,319 T650A probably benign Het
Alkbh7 T A 17: 56,998,979 S127T probably damaging Het
Ank3 G A 10: 69,991,629 A565T probably benign Het
App G T 16: 85,056,520 D223E unknown Het
Arhgef2 C A 3: 88,643,014 S675R probably damaging Het
Atg14 T C 14: 47,549,023 D258G probably damaging Het
Ckap2l T C 2: 129,269,114 D721G possibly damaging Het
Cog8 T C 8: 107,050,301 T481A probably benign Het
Colec10 C A 15: 54,462,213 probably null Het
Dhx9 T C 1: 153,456,643 probably benign Het
Dock1 T C 7: 134,990,541 M935T probably damaging Het
Dym T C 18: 75,080,226 V173A probably benign Het
Exoc3l4 A G 12: 111,428,697 Y583C probably damaging Het
Fam26e A T 10: 34,092,506 W184R probably damaging Het
Flnb G A 14: 7,867,551 V103M probably damaging Het
Fzd1 T A 5: 4,757,336 Q82L probably benign Het
Gabrr1 A G 4: 33,162,855 I474V probably benign Het
Galnt11 G T 5: 25,264,966 W521L probably damaging Het
Glb1l3 A G 9: 26,826,831 V420A probably benign Het
Gm5678 A T 16: 93,630,398 probably null Het
H1fnt A T 15: 98,257,007 L87* probably null Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Ihh T A 1: 74,946,511 T272S probably damaging Het
Il27ra T C 8: 84,031,550 M524V probably benign Het
Lman1l A T 9: 57,613,726 probably null Het
Mdp1 C A 14: 55,660,391 probably benign Het
Med12l A G 3: 59,257,407 K1436R probably damaging Het
Megf10 C T 18: 57,291,807 S1006F probably benign Het
Miga1 A T 3: 152,279,008 I426N probably damaging Het
Mtmr6 C T 14: 60,300,514 T654I possibly damaging Het
Nbeal1 A G 1: 60,330,942 S2673G possibly damaging Het
Nup93 T A 8: 94,302,088 H193Q probably benign Het
Olfr1303 A C 2: 111,814,060 L222W probably damaging Het
Olfr384 T A 11: 73,603,439 N286K probably damaging Het
Olfr629 T C 7: 103,740,668 N191D probably benign Het
Pdcd11 C T 19: 47,109,752 R826C probably damaging Het
Pde4dip G A 3: 97,755,591 R521* probably null Het
Phf2 T C 13: 48,826,182 S158G unknown Het
Pla2g15 A G 8: 106,163,194 E366G probably benign Het
Plekhm2 A T 4: 141,632,033 H494Q probably damaging Het
Prpsap2 A T 11: 61,749,064 M87K probably damaging Het
Rbm19 T G 5: 120,120,130 S137A probably benign Het
Ryr2 T A 13: 11,834,007 I363L probably benign Het
Samd9l T C 6: 3,376,896 T122A probably benign Het
Scn4a G C 11: 106,349,180 D70E probably benign Het
Slc12a3 T A 8: 94,335,004 V293D possibly damaging Het
Slc6a7 T C 18: 61,007,543 Y139C probably damaging Het
Slco2b1 A T 7: 99,690,555 C9* probably null Het
Slitrk1 A T 14: 108,911,303 S659T possibly damaging Het
Son T G 16: 91,655,156 S264A possibly damaging Het
Svep1 C A 4: 58,100,066 G1326V probably damaging Het
Tcf12 A G 9: 72,015,636 probably null Het
Ttn A G 2: 76,814,718 V11185A probably damaging Het
Ubap2 T C 4: 41,203,574 probably null Het
Utp15 G T 13: 98,250,609 F434L probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vsnl1 T G 12: 11,332,218 probably benign Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zbtb34 A C 2: 33,411,546 S328A probably damaging Het
Zdbf2 T C 1: 63,307,478 I1672T possibly damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 intron probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R7988:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTGAACCCATGATTCATG -3'
(R):5'- ACTCGGTGTTGAGACGTCATTG -3'

Sequencing Primer
(F):5'- TGGGGACATCATAGTGACTGAGAC -3'
(R):5'- CATTGGGGAGGTGGAGCC -3'
Posted On2018-06-06