Incidental Mutation 'R8271:Mylk'
ID 637743
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission 067652-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8271 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34745210-35002420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34922579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1154 (S1154P)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023538
AA Change: S1154P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: S1154P

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,686,212 I202L probably benign Het
Acadsb A T 7: 131,443,694 T452S unknown Het
Ago2 A T 15: 73,119,466 L541Q probably damaging Het
Ap2a2 A T 7: 141,620,899 E553V probably damaging Het
Astn2 T C 4: 65,992,426 K442E unknown Het
Bicd1 A G 6: 149,513,135 T449A probably benign Het
Btn1a1 T A 13: 23,461,749 Q150L probably benign Het
C1ra G A 6: 124,522,651 G599R probably damaging Het
Camta2 T A 11: 70,671,060 Q1076L probably benign Het
Capza2 T A 6: 17,657,215 C157S probably damaging Het
Ccnk A G 12: 108,195,855 probably benign Het
Chd3 T A 11: 69,360,657 D516V probably damaging Het
Cntnap5b A G 1: 100,072,107 T197A probably benign Het
Comp A G 8: 70,376,460 N260S probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Ddx60 T A 8: 61,940,108 probably null Het
Defb22 C T 2: 152,485,792 V158I unknown Het
Diaph3 T C 14: 86,866,513 S812G probably damaging Het
Dohh G T 10: 81,386,010 Q79H probably benign Het
Dyrk1b T G 7: 28,182,655 V147G probably benign Het
Fastkd2 C T 1: 63,748,024 T539I probably benign Het
Gm7534 G T 4: 134,202,967 T9K unknown Het
Itpr3 G A 17: 27,087,648 D229N probably damaging Het
Kcnv1 A T 15: 45,109,358 D376E probably benign Het
Kif13a C A 13: 46,752,581 V1577F probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Mcoln2 A C 3: 146,192,424 N100T unknown Het
Mdh1b C T 1: 63,720,005 V143M possibly damaging Het
Mfsd4b4 G T 10: 39,892,105 Q377K probably benign Het
Mpv17l T C 16: 13,944,720 F122S probably damaging Het
Myo5b A G 18: 74,627,190 Y259C probably damaging Het
Nek1 G A 8: 61,105,612 V931M probably benign Het
Nkd2 C A 13: 73,821,318 G343V probably damaging Het
Obox8 T A 7: 14,332,003 T197S probably benign Het
Olfr1029 T G 2: 85,975,741 M166R probably benign Het
Olfr1029 T C 2: 85,975,422 Y60H probably damaging Het
Olfr1086 T A 2: 86,676,874 H153L probably benign Het
Olfr1272 A G 2: 90,282,272 F101S possibly damaging Het
Olfr16 T A 1: 172,957,177 C127* probably null Het
Olfr309 G A 7: 86,306,754 R120C probably benign Het
Olfr480 A G 7: 108,065,773 S342P probably damaging Het
Palb2 A T 7: 122,124,874 S551T probably damaging Het
Pcdha12 T A 18: 37,021,900 D557E probably damaging Het
Pcdhb21 T A 18: 37,515,868 D683E probably benign Het
Plekhb1 A G 7: 100,656,729 probably benign Het
Plekhg5 A G 4: 152,103,007 N90D probably damaging Het
Pnpla1 A G 17: 28,881,605 D482G probably benign Het
Rc3h1 A T 1: 160,940,759 probably benign Het
Rfpl4 C T 7: 5,110,540 R214H probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Setd5 T C 6: 113,115,070 I284T possibly damaging Het
Smurf1 C T 5: 144,894,087 E293K possibly damaging Het
Tas2r106 A T 6: 131,678,060 I276N probably damaging Het
Tbc1d2 C A 4: 46,649,791 A82S possibly damaging Het
Tex19.2 A G 11: 121,117,184 I146T possibly damaging Het
Tmem107 T G 11: 69,071,455 N79K probably damaging Het
Tpsab1 A T 17: 25,345,331 S50T probably benign Het
Ttn T A 2: 76,723,250 K31008* probably null Het
Ubox5 T C 2: 130,599,709 T353A probably benign Het
Usp24 T A 4: 106,428,514 H2445Q probably damaging Het
Uvrag T C 7: 98,888,491 D499G probably benign Het
Xndc1 A T 7: 102,079,136 N247I possibly damaging Het
Yipf2 A T 9: 21,589,995 W226R probably damaging Het
Zfp335 T A 2: 164,898,053 Q793L probably damaging Het
Zfp385c A G 11: 100,657,465 S54P probably damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8540:Mylk UTSW 16 34929887 missense possibly damaging 0.87
R8721:Mylk UTSW 16 34996806 missense probably damaging 1.00
R8743:Mylk UTSW 16 34921057 missense probably benign 0.03
R8798:Mylk UTSW 16 34899402 missense possibly damaging 0.89
R8956:Mylk UTSW 16 34971409 missense probably benign 0.01
R9131:Mylk UTSW 16 34956465 missense probably benign 0.29
R9403:Mylk UTSW 16 34875642 nonsense probably null
R9624:Mylk UTSW 16 34879307 missense probably benign 0.29
R9735:Mylk UTSW 16 34914809 missense probably benign 0.09
R9756:Mylk UTSW 16 34914017 missense probably damaging 0.96
R9763:Mylk UTSW 16 34879112 nonsense probably null
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CTCGAAACCAGCTGGGAAAG -3'
(R):5'- CTCATGTGTATACCCAGGGC -3'

Sequencing Primer
(F):5'- CCAGCTGGGAAAGAAGAAGTC -3'
(R):5'- TCAGGCCATGGCTACAAGTGAC -3'
Posted On 2020-07-28