Incidental Mutation 'R4872:Mylk'
ID 376693
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission 042482-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4872 (G1)
Quality Score 200
Status Validated
Chromosome 16
Chromosomal Location 34745210-35002420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34914990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 780 (N780S)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000023538
AA Change: N780S

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: N780S

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232541
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 C A 15: 91,191,311 V100L probably benign Het
Acad11 G A 9: 104,086,266 probably benign Het
Actb C T 5: 142,905,552 probably benign Het
Ano9 G A 7: 141,107,204 A374V probably damaging Het
Baz2b T C 2: 59,942,759 probably null Het
Bpifb9b T A 2: 154,313,631 L350Q probably damaging Het
Cd27 T A 6: 125,234,318 probably null Het
Cd72 A G 4: 43,449,563 probably benign Het
Cdadc1 A T 14: 59,564,524 S516T probably benign Het
Chst5 T A 8: 111,890,560 I143F possibly damaging Het
Col20a1 T C 2: 180,997,363 V452A possibly damaging Het
Cox11 C A 11: 90,644,403 Q227K probably benign Het
Cpa6 A G 1: 10,595,618 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpm2 T C 2: 32,571,191 probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Frem1 A C 4: 82,963,150 N1273K probably damaging Het
Fry T C 5: 150,394,239 probably null Het
Gm10306 G T 4: 94,556,832 probably benign Het
Gm5565 T C 5: 146,158,103 T278A probably benign Het
Gm8180 A G 14: 43,782,345 I40T probably benign Het
Iah1 T C 12: 21,317,425 V44A probably benign Het
Iqgap3 C T 3: 88,113,128 P360S probably damaging Het
Klhl28 T A 12: 64,957,122 I206F possibly damaging Het
Krt13 A G 11: 100,121,506 probably benign Het
Lipo2 T A 19: 33,749,514 D41V probably benign Het
Lrig2 C G 3: 104,491,526 V229L possibly damaging Het
Lrrc32 C T 7: 98,498,520 T169I probably damaging Het
Lrriq1 T C 10: 103,178,788 N1053S possibly damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mgat4c G C 10: 102,388,738 R271P probably damaging Het
N4bp1 T C 8: 86,861,048 T421A probably benign Het
Nat8f1 T C 6: 85,910,313 T222A probably benign Het
Nsun2 T C 13: 69,543,873 probably benign Het
Oas2 T A 5: 120,738,534 D448V probably damaging Het
Olfr129 C A 17: 38,055,576 V6F probably benign Het
Olfr168 A T 16: 19,530,633 C96S probably damaging Het
Olfr992 T C 2: 85,400,428 Y35C probably damaging Het
Pgm2l1 T A 7: 100,227,997 L25Q probably damaging Het
Pigp A T 16: 94,365,450 V133D probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pomt2 C T 12: 87,110,107 D752N possibly damaging Het
Ppat T C 5: 76,926,793 K65E probably damaging Het
Ptprn2 T C 12: 117,161,694 L616P probably damaging Het
Rad54l2 A G 9: 106,717,892 S289P probably damaging Het
Rbm39 G A 2: 156,177,346 R31C possibly damaging Het
Rhbdf2 C A 11: 116,601,945 V417L probably benign Het
Rnf157 T A 11: 116,355,472 E255D possibly damaging Het
Rpl6l A T 10: 111,126,443 noncoding transcript Het
Sec24c A G 14: 20,693,745 D1006G probably damaging Het
Sh3bp1 G T 15: 78,908,037 A401S probably benign Het
Slc17a8 A T 10: 89,576,505 D539E probably benign Het
Slc38a9 T A 13: 112,689,564 S136R probably damaging Het
Smoc2 A C 17: 14,369,033 T255P probably benign Het
Smyd2 T C 1: 189,896,650 D152G probably damaging Het
Stab1 A G 14: 31,140,393 V2328A probably damaging Het
Taar2 A G 10: 23,940,693 I44V probably benign Het
Tbc1d4 T C 14: 101,444,708 K1251E probably benign Het
Thada G A 17: 84,446,599 L315F probably damaging Het
Trbv14 T C 6: 41,135,325 S19P probably benign Het
Ttc39c T C 18: 12,687,116 probably benign Het
Ttc39d A G 17: 80,217,098 I395M probably benign Het
Ttn T C 2: 76,718,384 E31891G probably damaging Het
Ubr3 T C 2: 69,970,183 V950A probably damaging Het
Uhrf1bp1 G T 17: 27,890,136 D1110Y probably benign Het
Usp9y T A Y: 1,307,920 K2305N probably damaging Het
Vmn1r158 G A 7: 22,790,754 T10I possibly damaging Het
Vmn2r78 T A 7: 86,954,708 I698K possibly damaging Het
Vmn2r86 G T 10: 130,453,591 T145K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp51 T C 17: 21,464,671 V516A probably benign Het
Zfp654 A T 16: 64,785,782 S686T probably benign Het
Zfp846 T A 9: 20,590,815 C55S probably benign Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8271:Mylk UTSW 16 34922579 missense probably damaging 0.97
R8540:Mylk UTSW 16 34929887 missense possibly damaging 0.87
R8721:Mylk UTSW 16 34996806 missense probably damaging 1.00
R8743:Mylk UTSW 16 34921057 missense probably benign 0.03
R8798:Mylk UTSW 16 34899402 missense possibly damaging 0.89
R8956:Mylk UTSW 16 34971409 missense probably benign 0.01
R9131:Mylk UTSW 16 34956465 missense probably benign 0.29
R9403:Mylk UTSW 16 34875642 nonsense probably null
R9624:Mylk UTSW 16 34879307 missense probably benign 0.29
R9735:Mylk UTSW 16 34914809 missense probably benign 0.09
R9756:Mylk UTSW 16 34914017 missense probably damaging 0.96
R9763:Mylk UTSW 16 34879112 nonsense probably null
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGCCCTGGTTCATCAGCAAG -3'
(R):5'- TCGCCAATTAAAGCTGCCAG -3'

Sequencing Primer
(F):5'- TGGTTCATCAGCAAGCCTCG -3'
(R):5'- ATTAAAGCTGCCAGCCTCGGAG -3'
Posted On 2016-03-17