Incidental Mutation 'R0106:Chd6'
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission 038392-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R0106 (G1)
Quality Score167
Status Validated
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160967902 bp
Amino Acid Change Phenylalanine to Leucine at position 1480 (F1480L)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: F1480L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: F1480L

low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137152
Meta Mutation Damage Score 0.6473 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik A T 12: 112,415,194 noncoding transcript Het
Abcb9 T C 5: 124,083,060 N276S possibly damaging Het
Arhgef25 A G 10: 127,184,010 probably null Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Aspm C A 1: 139,476,876 Q1315K probably benign Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
BC055324 T C 1: 163,982,811 probably benign Het
Brf1 A G 12: 112,973,463 probably benign Het
Card19 A C 13: 49,208,145 D3E probably benign Het
Ckap5 T C 2: 91,578,205 I915T possibly damaging Het
Ckap5 T A 2: 91,615,840 I1836N probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Cramp1l A G 17: 24,972,376 V1037A probably benign Het
Cspg5 C A 9: 110,246,532 P112Q probably damaging Het
Cyp2g1 T A 7: 26,814,182 I182N probably damaging Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Ephb6 T C 6: 41,619,594 probably benign Het
Fkbp6 C T 5: 135,340,004 R234Q probably benign Het
Gda T C 19: 21,397,556 D332G probably benign Het
Ggt7 C T 2: 155,494,893 A560T possibly damaging Het
Glis3 A T 19: 28,531,868 S239T possibly damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hsdl1 T A 8: 119,565,778 S254C probably damaging Het
Igsf6 T A 7: 121,074,454 I18F probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kif13a G T 13: 46,825,347 probably benign Het
Kif14 T C 1: 136,479,924 probably benign Het
L2hgdh A T 12: 69,705,789 Y239* probably null Het
Lama3 T C 18: 12,403,982 V228A probably damaging Het
Lamp1 A G 8: 13,174,550 T405A probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk12 T C 15: 89,132,984 probably benign Het
Mdga2 A T 12: 66,716,706 N205K probably damaging Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nat10 A G 2: 103,757,205 V55A probably damaging Het
Nlrp10 T C 7: 108,925,322 E317G possibly damaging Het
Nomo1 T C 7: 46,037,632 I72T probably damaging Het
Olfr1450 A G 19: 12,954,356 I256V probably benign Het
Olfr974 GC G 9: 39,942,823 probably null Het
Pappa2 C T 1: 158,714,977 C1780Y probably damaging Het
Pgm2l1 A G 7: 100,250,373 M65V probably benign Het
Plec C T 15: 76,176,318 E3162K probably damaging Het
Pnisr T C 4: 21,874,617 probably benign Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Prss34 A T 17: 25,298,726 D25V probably damaging Het
Ptpn1 T C 2: 167,976,418 probably benign Het
Pygb A G 2: 150,806,203 D119G probably benign Het
Racgap1 T C 15: 99,642,958 T4A possibly damaging Het
Rap1gap2 A G 11: 74,435,744 C166R probably benign Het
Rbm28 C A 6: 29,127,803 V705L probably benign Het
Rgs1 C T 1: 144,248,549 V50M probably benign Het
Rgs12 C T 5: 34,966,664 T597I probably benign Het
Ros1 T C 10: 52,142,267 N765S possibly damaging Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scube2 A G 7: 109,846,908 probably benign Het
Serpinb10 T A 1: 107,546,744 L212Q probably damaging Het
Slc6a7 A G 18: 61,002,223 V411A probably benign Het
Slco1a6 A T 6: 142,157,390 probably benign Het
Smc1b A T 15: 85,070,819 D1077E probably damaging Het
Srek1 G A 13: 103,743,623 H476Y unknown Het
Strn3 A G 12: 51,621,788 V673A probably benign Het
Tepsin T C 11: 120,091,811 probably null Het
Timmdc1 A C 16: 38,522,362 L58R probably damaging Het
Tmem132c T C 5: 127,554,669 V664A possibly damaging Het
Tmem241 A T 18: 12,106,009 probably benign Het
Tmprss15 T C 16: 79,003,389 D602G probably damaging Het
Trbv15 T C 6: 41,141,265 probably benign Het
Wdr70 A T 15: 8,019,587 probably null Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160950003 missense probably damaging 1.00
R7509:Chd6 UTSW 2 161013154 missense probably damaging 1.00
R7699:Chd6 UTSW 2 161025943 missense probably benign 0.13
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160990321 missense probably damaging 1.00
R8261:Chd6 UTSW 2 160957082 missense probably damaging 1.00
R8317:Chd6 UTSW 2 160990321 missense probably damaging 1.00
R8388:Chd6 UTSW 2 161019651 missense probably damaging 1.00
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cgatgaccaagaaatagcacag -3'
Posted On2013-07-30