Mutagenetix > Incidental Mutation

Incidental Mutation 'R0106:Chd6'

63323

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

038392-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.687) question?

Stock #

R0106 (G1)

Quality Score

167

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160967902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1480 (F1480L)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: F1480L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: F1480L

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137152

Meta Mutation Damage Score

0.6473

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 95.9%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730018C14Rik	A	T	12: 112,415,194		noncoding transcript	Het
Abcb9	T	C	5: 124,083,060	N276S	possibly damaging	Het
Arhgef25	A	G	10: 127,184,010		probably null	Het
Asic4	T	C	1: 75,451,127	V99A	probably benign	Het
Aspm	C	A	1: 139,476,876	Q1315K	probably benign	Het
B3galnt2	T	C	13: 13,995,793	S243P	probably benign	Het
BC055324	T	C	1: 163,982,811		probably benign	Het
Brf1	A	G	12: 112,973,463		probably benign	Het
Card19	A	C	13: 49,208,145	D3E	probably benign	Het
Ckap5	T	A	2: 91,615,840	I1836N	probably damaging	Het
Ckap5	T	C	2: 91,578,205	I915T	possibly damaging	Het
Cpb1	T	C	3: 20,266,533		probably null	Het
Cramp1l	A	G	17: 24,972,376	V1037A	probably benign	Het
Cspg5	C	A	9: 110,246,532	P112Q	probably damaging	Het
Cyp2g1	T	A	7: 26,814,182	I182N	probably damaging	Het
Dscc1	C	A	15: 55,083,570	C253F	probably benign	Het
Dysf	C	A	6: 84,113,336	F956L	probably benign	Het
Ephb6	T	C	6: 41,619,594		probably benign	Het
Fkbp6	C	T	5: 135,340,004	R234Q	probably benign	Het
Gda	T	C	19: 21,397,556	D332G	probably benign	Het
Ggt7	C	T	2: 155,494,893	A560T	possibly damaging	Het
Glis3	A	T	19: 28,531,868	S239T	possibly damaging	Het
Gm10845	T	A	14: 79,863,204		noncoding transcript	Het
H2-M5	A	G	17: 36,989,142	F47L	possibly damaging	Het
Hsdl1	T	A	8: 119,565,778	S254C	probably damaging	Het
Igsf6	T	A	7: 121,074,454	I18F	probably benign	Het
Immt	A	G	6: 71,851,844	S128G	probably benign	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Kif13a	G	T	13: 46,825,347		probably benign	Het
Kif14	T	C	1: 136,479,924		probably benign	Het
L2hgdh	A	T	12: 69,705,789	Y239*	probably null	Het
Lama3	T	C	18: 12,403,982	V228A	probably damaging	Het
Lamp1	A	G	8: 13,174,550	T405A	probably damaging	Het
Lpin1	A	T	12: 16,540,979	N817K	possibly damaging	Het
Luzp1	A	G	4: 136,542,685	K740E	probably damaging	Het
Mapk12	T	C	15: 89,132,984		probably benign	Het
Mdga2	A	T	12: 66,716,706	N205K	probably damaging	Het
Myo1a	A	G	10: 127,719,880	I913V	probably benign	Het
Nat10	A	G	2: 103,757,205	V55A	probably damaging	Het
Nlrp10	T	C	7: 108,925,322	E317G	possibly damaging	Het
Nomo1	T	C	7: 46,037,632	I72T	probably damaging	Het
Olfr1450	A	G	19: 12,954,356	I256V	probably benign	Het
Olfr974	GC	G	9: 39,942,823		probably null	Het
Pappa2	C	T	1: 158,714,977	C1780Y	probably damaging	Het
Pgm2l1	A	G	7: 100,250,373	M65V	probably benign	Het
Plec	C	T	15: 76,176,318	E3162K	probably damaging	Het
Pnisr	T	C	4: 21,874,617		probably benign	Het
Pop7	A	G	5: 137,501,649	*141Q	probably null	Het
Prss34	A	T	17: 25,298,726	D25V	probably damaging	Het
Ptpn1	T	C	2: 167,976,418		probably benign	Het
Pygb	A	G	2: 150,806,203	D119G	probably benign	Het
Racgap1	T	C	15: 99,642,958	T4A	possibly damaging	Het
Rap1gap2	A	G	11: 74,435,744	C166R	probably benign	Het
Rbm28	C	A	6: 29,127,803	V705L	probably benign	Het
Rgs1	C	T	1: 144,248,549	V50M	probably benign	Het
Rgs12	C	T	5: 34,966,664	T597I	probably benign	Het
Ros1	T	C	10: 52,142,267	N765S	possibly damaging	Het
Ruvbl1	A	G	6: 88,473,200	R58G	probably damaging	Het
Scube2	A	G	7: 109,846,908		probably benign	Het
Serpinb10	T	A	1: 107,546,744	L212Q	probably damaging	Het
Slc6a7	A	G	18: 61,002,223	V411A	probably benign	Het
Slco1a6	A	T	6: 142,157,390		probably benign	Het
Smc1b	A	T	15: 85,070,819	D1077E	probably damaging	Het
Srek1	G	A	13: 103,743,623	H476Y	unknown	Het
Strn3	A	G	12: 51,621,788	V673A	probably benign	Het
Tepsin	T	C	11: 120,091,811		probably null	Het
Timmdc1	A	C	16: 38,522,362	L58R	probably damaging	Het
Tmem132c	T	C	5: 127,554,669	V664A	possibly damaging	Het
Tmem241	A	T	18: 12,106,009		probably benign	Het
Tmprss15	T	C	16: 79,003,389	D602G	probably damaging	Het
Trbv15	T	C	6: 41,141,265		probably benign	Het
Wdr70	A	T	15: 8,019,587		probably null	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8867:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160981623	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	161029873	nonsense	probably null
R9270:Chd6	UTSW	2	161029873	nonsense	probably null
R9310:Chd6	UTSW	2	161039261	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	161029864	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160957158	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160960339	missense	probably benign
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTCCCTGCTGACATAGTGACAAG -3'
(R):5'- AAGGTGATGGACATAGGCCACCAC -3'

Sequencing Primer
(F):5'- GCTGACATAGTGACAAGAGTCTTC -3'
(R):5'- cgatgaccaagaaatagcacag -3'

Posted On

2013-07-30