Incidental Mutation 'R9367:Chd6'
ID 709030
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Name chromodomain helicase DNA binding protein 6
Synonyms 6330406J24Rik, 5430439G14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock # R9367 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 160946978-161109075 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 161029864 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 217 (I217K)
Ref Sequence ENSEMBL: ENSMUSP00000117075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000130265] [ENSMUST00000134178]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039782
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130265
AA Change: I217K

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117075
Gene: ENSMUSG00000057133
AA Change: I217K

DomainStartEndE-ValueType
low complexity region 1 23 N/A INTRINSIC
Blast:CHROMO 26 210 4e-80 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000134178
SMART Domains Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
CHROMO 288 354 1.35e-4 SMART
CHROMO 371 429 3.48e-7 SMART
DEXDc 455 657 1.73e-39 SMART
HELICc 811 895 3.84e-23 SMART
low complexity region 1079 1093 N/A INTRINSIC
Blast:DEXDc 1107 1152 4e-23 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
4930402H24Rik A T 2: 130,739,460 N678K probably benign Het
4930568D16Rik A T 2: 35,354,927 Y138N probably benign Het
Abca4 T C 3: 122,044,548 M1T probably null Het
Acer3 A G 7: 98,259,414 V104A probably damaging Het
Agpat4 A G 17: 12,216,710 E287G probably benign Het
Akip1 C T 7: 109,708,949 A146V unknown Het
Ank2 T C 3: 126,945,029 N2402S unknown Het
Arhgdig A T 17: 26,199,477 Y177* probably null Het
Arhgef38 T A 3: 133,142,237 T355S unknown Het
Atp8a2 C A 14: 60,012,378 probably null Het
Atp8b4 A G 2: 126,374,510 I672T probably damaging Het
Baat T A 4: 49,503,008 D38V probably damaging Het
Bcl9 T C 3: 97,210,545 S278G probably benign Het
Ccdc150 C T 1: 54,285,601 L350F probably damaging Het
Ceacam20 T G 7: 19,971,608 S175A probably damaging Het
Cnppd1 T C 1: 75,140,973 I35V probably benign Het
Col15a1 T C 4: 47,245,603 I118T probably damaging Het
Csmd3 A T 15: 47,704,168 Y1289N Het
Dio2 T C 12: 90,729,813 T134A probably benign Het
Dnah17 A G 11: 118,096,638 V1282A possibly damaging Het
Dnah17 A G 11: 118,121,386 S517P possibly damaging Het
Dync2h1 C T 9: 7,125,730 probably null Het
Echdc2 C A 4: 108,178,914 P274Q probably damaging Het
Fam117a T A 11: 95,380,744 C381S probably damaging Het
Fbxl12 A G 9: 20,638,834 F122S probably damaging Het
Gen1 G A 12: 11,241,308 Q892* probably null Het
Gimap4 A G 6: 48,690,812 Y167C probably damaging Het
Gle1 T A 2: 29,949,002 F476L probably damaging Het
Gpr135 A T 12: 72,070,699 V98E possibly damaging Het
Greb1l A T 18: 10,522,130 H742L probably benign Het
Habp2 G T 19: 56,316,349 C392F probably damaging Het
Hapln3 G T 7: 79,121,707 R145S probably damaging Het
Ikbkb A G 8: 22,681,695 C179R probably damaging Het
Kat6a A T 8: 22,910,140 I306L possibly damaging Het
Lmo3 A T 6: 138,365,960 Y140* probably null Het
Lrrc32 T A 7: 98,499,730 N572K probably damaging Het
Lrrn1 T A 6: 107,568,132 M297K probably damaging Het
Magi2 G A 5: 20,561,310 V676I probably damaging Het
Mdga1 T C 17: 29,832,308 *957W probably null Het
Mip G T 10: 128,227,160 G158V probably damaging Het
Mmp14 T C 14: 54,440,503 I527T probably benign Het
Mmp27 G A 9: 7,573,549 G188D probably damaging Het
Mylk4 A T 13: 32,776,253 C17S possibly damaging Het
Naa50 T G 16: 44,157,191 I94R probably damaging Het
Nyap1 A T 5: 137,735,986 Y262N probably damaging Het
Obsl1 A G 1: 75,489,533 V1517A probably benign Het
P4htm T A 9: 108,581,948 M262L probably benign Het
Pappa2 T C 1: 158,956,972 E156G probably benign Het
Pcdhb15 A T 18: 37,474,918 Y401F possibly damaging Het
Pde2a G A 7: 101,511,154 R845H probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Penk C T 4: 4,134,097 M183I probably benign Het
Pole T C 5: 110,297,089 V437A probably damaging Het
Ppp1r7 T C 1: 93,351,540 I114T probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Pwp2 G A 10: 78,178,993 Q386* probably null Het
Rad17 A T 13: 100,633,212 S280T possibly damaging Het
Rhebl1 C T 15: 98,878,533 E128K possibly damaging Het
Sema3e G T 5: 14,241,070 V615L probably benign Het
Slc22a2 A T 17: 12,605,950 Y233F probably benign Het
Ssu2 A G 6: 112,381,014 S123P probably damaging Het
Stk10 A G 11: 32,588,878 E239G Het
Surf6 G T 2: 26,892,368 Q316K probably damaging Het
Tcerg1 G A 18: 42,552,508 D637N possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnxb C A 17: 34,713,019 F2175L probably damaging Het
Trp53i11 G C 2: 93,198,928 V91L probably benign Het
Tspan9 A G 6: 127,967,139 V66A probably damaging Het
Usp16 C T 16: 87,464,781 T95M probably benign Het
Usp9y A T Y: 1,324,982 F1691Y probably damaging Het
Uty A T Y: 1,099,584 L1204I possibly damaging Het
Vmn1r192 A T 13: 22,187,630 V140D possibly damaging Het
Vps54 T C 11: 21,300,234 V552A probably benign Het
Vps8 T C 16: 21,521,918 V804A possibly damaging Het
Zfp869 A C 8: 69,708,407 L33R probably damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160950003 missense probably damaging 1.00
R7509:Chd6 UTSW 2 161013154 missense probably damaging 1.00
R7699:Chd6 UTSW 2 161025943 missense probably benign 0.13
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160990321 missense probably damaging 1.00
R8261:Chd6 UTSW 2 160957082 missense probably damaging 1.00
R8317:Chd6 UTSW 2 160990321 missense probably damaging 1.00
R8388:Chd6 UTSW 2 161019651 missense probably damaging 1.00
R8865:Chd6 UTSW 2 161021069 missense probably benign 0.10
R8867:Chd6 UTSW 2 161021069 missense probably benign 0.10
R8996:Chd6 UTSW 2 160981623 missense probably damaging 1.00
R9091:Chd6 UTSW 2 161029873 nonsense probably null
R9270:Chd6 UTSW 2 161029873 nonsense probably null
R9310:Chd6 UTSW 2 161039261 missense probably damaging 1.00
R9438:Chd6 UTSW 2 160957158 missense probably benign 0.01
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGAATGTAGGCAGGTAGC -3'
(R):5'- TCCCTCCTAAAATGAGGCATAG -3'

Sequencing Primer
(F):5'- AAACTTGTCAGTCCTCAGGG -3'
(R):5'- CCTCCTAAAATGAGGCATAGGTATTG -3'
Posted On 2022-04-18