Incidental Mutation 'R9367:Chd6'
ID 709030
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Name chromodomain helicase DNA binding protein 6
Synonyms 5430439G14Rik, 6330406J24Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.755) question?
Stock # R9367 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 160788898-160950995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 160871784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 217 (I217K)
Ref Sequence ENSEMBL: ENSMUSP00000117075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000130265] [ENSMUST00000134178]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039782
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130265
AA Change: I217K

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117075
Gene: ENSMUSG00000057133
AA Change: I217K

DomainStartEndE-ValueType
low complexity region 1 23 N/A INTRINSIC
Blast:CHROMO 26 210 4e-80 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000134178
SMART Domains Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
CHROMO 288 354 1.35e-4 SMART
CHROMO 371 429 3.48e-7 SMART
DEXDc 455 657 1.73e-39 SMART
HELICc 811 895 3.84e-23 SMART
low complexity region 1079 1093 N/A INTRINSIC
Blast:DEXDc 1107 1152 4e-23 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
4930568D16Rik A T 2: 35,244,939 (GRCm39) Y138N probably benign Het
Abca4 T C 3: 121,838,197 (GRCm39) M1T probably null Het
Acer3 A G 7: 97,908,621 (GRCm39) V104A probably damaging Het
Agpat4 A G 17: 12,435,597 (GRCm39) E287G probably benign Het
Akip1 C T 7: 109,308,156 (GRCm39) A146V unknown Het
Ank2 T C 3: 126,738,678 (GRCm39) N2402S unknown Het
Arhgdig A T 17: 26,418,451 (GRCm39) Y177* probably null Het
Arhgef38 T A 3: 132,847,998 (GRCm39) T355S unknown Het
Atp8a2 C A 14: 60,249,827 (GRCm39) probably null Het
Atp8b4 A G 2: 126,216,430 (GRCm39) I672T probably damaging Het
Baat T A 4: 49,503,008 (GRCm39) D38V probably damaging Het
Bcl9 T C 3: 97,117,861 (GRCm39) S278G probably benign Het
Ccdc150 C T 1: 54,324,760 (GRCm39) L350F probably damaging Het
Ceacam20 T G 7: 19,705,533 (GRCm39) S175A probably damaging Het
Cnppd1 T C 1: 75,117,617 (GRCm39) I35V probably benign Het
Col15a1 T C 4: 47,245,603 (GRCm39) I118T probably damaging Het
Csmd3 A T 15: 47,567,564 (GRCm39) Y1289N Het
Dio2 T C 12: 90,696,587 (GRCm39) T134A probably benign Het
Dnaaf9 A T 2: 130,581,380 (GRCm39) N678K probably benign Het
Dnah17 A G 11: 117,987,464 (GRCm39) V1282A possibly damaging Het
Dnah17 A G 11: 118,012,212 (GRCm39) S517P possibly damaging Het
Dync2h1 C T 9: 7,125,730 (GRCm39) probably null Het
Echdc2 C A 4: 108,036,111 (GRCm39) P274Q probably damaging Het
Fam117a T A 11: 95,271,570 (GRCm39) C381S probably damaging Het
Fbxl12 A G 9: 20,550,130 (GRCm39) F122S probably damaging Het
Gen1 G A 12: 11,291,309 (GRCm39) Q892* probably null Het
Gimap4 A G 6: 48,667,746 (GRCm39) Y167C probably damaging Het
Gle1 T A 2: 29,839,014 (GRCm39) F476L probably damaging Het
Gpr135 A T 12: 72,117,473 (GRCm39) V98E possibly damaging Het
Greb1l A T 18: 10,522,130 (GRCm39) H742L probably benign Het
Habp2 G T 19: 56,304,781 (GRCm39) C392F probably damaging Het
Hapln3 G T 7: 78,771,455 (GRCm39) R145S probably damaging Het
Ikbkb A G 8: 23,171,711 (GRCm39) C179R probably damaging Het
Kat6a A T 8: 23,400,156 (GRCm39) I306L possibly damaging Het
Lmo3 A T 6: 138,342,958 (GRCm39) Y140* probably null Het
Lrrc32 T A 7: 98,148,937 (GRCm39) N572K probably damaging Het
Lrrn1 T A 6: 107,545,093 (GRCm39) M297K probably damaging Het
Magi2 G A 5: 20,766,308 (GRCm39) V676I probably damaging Het
Mdga1 T C 17: 30,051,282 (GRCm39) *957W probably null Het
Mip G T 10: 128,063,029 (GRCm39) G158V probably damaging Het
Mmp14 T C 14: 54,677,960 (GRCm39) I527T probably benign Het
Mmp27 G A 9: 7,573,550 (GRCm39) G188D probably damaging Het
Mylk4 A T 13: 32,960,236 (GRCm39) C17S possibly damaging Het
Naa50 T G 16: 43,977,554 (GRCm39) I94R probably damaging Het
Nyap1 A T 5: 137,734,248 (GRCm39) Y262N probably damaging Het
Obsl1 A G 1: 75,466,177 (GRCm39) V1517A probably benign Het
P4htm T A 9: 108,459,147 (GRCm39) M262L probably benign Het
Pappa2 T C 1: 158,784,542 (GRCm39) E156G probably benign Het
Pcdhb15 A T 18: 37,607,971 (GRCm39) Y401F possibly damaging Het
Pde2a G A 7: 101,160,361 (GRCm39) R845H probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Penk C T 4: 4,134,097 (GRCm39) M183I probably benign Het
Pole T C 5: 110,444,955 (GRCm39) V437A probably damaging Het
Ppp1r7 T C 1: 93,279,262 (GRCm39) I114T probably damaging Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Pwp2 G A 10: 78,014,827 (GRCm39) Q386* probably null Het
Rad17 A T 13: 100,769,720 (GRCm39) S280T possibly damaging Het
Rhebl1 C T 15: 98,776,414 (GRCm39) E128K possibly damaging Het
Sema3e G T 5: 14,291,084 (GRCm39) V615L probably benign Het
Slc22a2 A T 17: 12,824,837 (GRCm39) Y233F probably benign Het
Ssu2 A G 6: 112,357,975 (GRCm39) S123P probably damaging Het
Stk10 A G 11: 32,538,878 (GRCm39) E239G Het
Surf6 G T 2: 26,782,380 (GRCm39) Q316K probably damaging Het
Tcerg1 G A 18: 42,685,573 (GRCm39) D637N possibly damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tnxb C A 17: 34,931,993 (GRCm39) F2175L probably damaging Het
Trp53i11 G C 2: 93,029,273 (GRCm39) V91L probably benign Het
Tspan9 A G 6: 127,944,102 (GRCm39) V66A probably damaging Het
Usp16 C T 16: 87,261,669 (GRCm39) T95M probably benign Het
Usp9y A T Y: 1,324,982 (GRCm39) F1691Y probably damaging Het
Uty A T Y: 1,099,584 (GRCm39) L1204I possibly damaging Het
Vmn1r192 A T 13: 22,371,800 (GRCm39) V140D possibly damaging Het
Vps54 T C 11: 21,250,234 (GRCm39) V552A probably benign Het
Vps8 T C 16: 21,340,668 (GRCm39) V804A possibly damaging Het
Zfp869 A C 8: 70,161,057 (GRCm39) L33R probably damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 160,883,999 (GRCm39) missense probably benign 0.01
IGL00899:Chd6 APN 2 160,871,218 (GRCm39) splice site probably benign
IGL01104:Chd6 APN 2 160,803,847 (GRCm39) missense probably damaging 1.00
IGL01295:Chd6 APN 2 160,830,290 (GRCm39) splice site probably benign
IGL01717:Chd6 APN 2 160,807,179 (GRCm39) missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160,803,294 (GRCm39) missense probably benign 0.00
IGL01814:Chd6 APN 2 160,901,849 (GRCm39) missense probably benign 0.25
IGL02016:Chd6 APN 2 160,825,598 (GRCm39) missense probably damaging 1.00
IGL02104:Chd6 APN 2 160,819,432 (GRCm39) missense probably benign
IGL02158:Chd6 APN 2 160,868,212 (GRCm39) missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160,807,595 (GRCm39) missense probably damaging 1.00
IGL02472:Chd6 APN 2 160,826,372 (GRCm39) splice site probably benign
IGL02522:Chd6 APN 2 160,807,716 (GRCm39) missense probably benign 0.30
IGL02626:Chd6 APN 2 160,881,270 (GRCm39) splice site probably benign
IGL02727:Chd6 APN 2 160,811,383 (GRCm39) missense probably damaging 0.96
IGL02738:Chd6 APN 2 160,807,618 (GRCm39) missense probably benign 0.45
IGL02743:Chd6 APN 2 160,802,183 (GRCm39) missense probably damaging 1.00
IGL02800:Chd6 APN 2 160,826,552 (GRCm39) missense probably damaging 1.00
IGL02811:Chd6 APN 2 160,832,221 (GRCm39) missense probably damaging 1.00
IGL02850:Chd6 APN 2 160,861,536 (GRCm39) nonsense probably null
IGL02979:Chd6 APN 2 160,808,090 (GRCm39) missense possibly damaging 0.48
IGL02993:Chd6 APN 2 160,894,304 (GRCm39) splice site probably benign
IGL03277:Chd6 APN 2 160,824,981 (GRCm39) missense probably null 1.00
IGL03346:Chd6 APN 2 160,802,282 (GRCm39) missense probably benign 0.00
IGL03357:Chd6 APN 2 160,859,936 (GRCm39) splice site probably benign
IGL03134:Chd6 UTSW 2 160,807,403 (GRCm39) missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0212:Chd6 UTSW 2 160,894,767 (GRCm39) missense probably damaging 0.99
R0363:Chd6 UTSW 2 160,856,244 (GRCm39) missense probably damaging 1.00
R0399:Chd6 UTSW 2 160,894,608 (GRCm39) missense probably damaging 1.00
R0511:Chd6 UTSW 2 160,834,111 (GRCm39) missense probably damaging 0.99
R0771:Chd6 UTSW 2 160,861,500 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1184:Chd6 UTSW 2 160,872,722 (GRCm39) missense probably damaging 1.00
R1277:Chd6 UTSW 2 160,809,735 (GRCm39) missense probably damaging 1.00
R1396:Chd6 UTSW 2 160,825,023 (GRCm39) missense probably damaging 1.00
R1647:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1648:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1745:Chd6 UTSW 2 160,823,587 (GRCm39) missense probably damaging 0.96
R1766:Chd6 UTSW 2 160,808,559 (GRCm39) missense probably damaging 1.00
R1871:Chd6 UTSW 2 160,832,176 (GRCm39) missense probably damaging 1.00
R1928:Chd6 UTSW 2 160,809,920 (GRCm39) splice site probably benign
R1973:Chd6 UTSW 2 160,808,307 (GRCm39) missense probably damaging 0.99
R2200:Chd6 UTSW 2 160,825,673 (GRCm39) missense probably damaging 1.00
R2340:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2341:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2519:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160,809,800 (GRCm39) missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160,808,472 (GRCm39) small deletion probably benign
R3426:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R3427:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R4042:Chd6 UTSW 2 160,830,253 (GRCm39) missense probably damaging 1.00
R4273:Chd6 UTSW 2 160,803,211 (GRCm39) missense probably benign 0.04
R4360:Chd6 UTSW 2 160,791,776 (GRCm39) missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160,807,238 (GRCm39) missense probably benign
R4458:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R4583:Chd6 UTSW 2 160,856,114 (GRCm39) missense probably damaging 1.00
R4625:Chd6 UTSW 2 160,811,412 (GRCm39) missense probably damaging 1.00
R4740:Chd6 UTSW 2 160,812,103 (GRCm39) missense probably benign
R4765:Chd6 UTSW 2 160,808,164 (GRCm39) nonsense probably null
R4779:Chd6 UTSW 2 160,791,477 (GRCm39) missense probably damaging 1.00
R4877:Chd6 UTSW 2 160,871,219 (GRCm39) splice site probably benign
R5068:Chd6 UTSW 2 160,808,289 (GRCm39) missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160,791,873 (GRCm39) missense probably damaging 1.00
R5275:Chd6 UTSW 2 160,811,283 (GRCm39) missense probably benign
R5405:Chd6 UTSW 2 160,807,310 (GRCm39) missense probably benign
R5598:Chd6 UTSW 2 160,856,032 (GRCm39) missense probably damaging 1.00
R5693:Chd6 UTSW 2 160,807,185 (GRCm39) missense probably benign
R5697:Chd6 UTSW 2 160,859,971 (GRCm39) missense probably damaging 1.00
R5715:Chd6 UTSW 2 160,791,798 (GRCm39) missense probably benign 0.00
R5759:Chd6 UTSW 2 160,825,682 (GRCm39) missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160,798,999 (GRCm39) missense probably damaging 1.00
R5761:Chd6 UTSW 2 160,798,998 (GRCm39) missense probably damaging 1.00
R5954:Chd6 UTSW 2 160,807,747 (GRCm39) missense probably benign 0.00
R6025:Chd6 UTSW 2 160,807,502 (GRCm39) missense probably benign
R6104:Chd6 UTSW 2 160,856,052 (GRCm39) missense probably damaging 1.00
R6247:Chd6 UTSW 2 160,791,968 (GRCm39) missense probably damaging 1.00
R6393:Chd6 UTSW 2 160,821,407 (GRCm39) missense probably damaging 1.00
R6452:Chd6 UTSW 2 160,807,418 (GRCm39) missense possibly damaging 0.76
R6468:Chd6 UTSW 2 160,854,987 (GRCm39) missense probably damaging 1.00
R6784:Chd6 UTSW 2 160,808,174 (GRCm39) missense probably damaging 1.00
R6803:Chd6 UTSW 2 160,802,279 (GRCm39) missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160,807,650 (GRCm39) missense probably benign
R6895:Chd6 UTSW 2 160,830,260 (GRCm39) missense probably damaging 1.00
R6925:Chd6 UTSW 2 160,855,047 (GRCm39) missense probably damaging 0.98
R7061:Chd6 UTSW 2 160,867,885 (GRCm39) nonsense probably null
R7064:Chd6 UTSW 2 160,791,983 (GRCm39) missense probably damaging 1.00
R7248:Chd6 UTSW 2 160,803,199 (GRCm39) nonsense probably null
R7287:Chd6 UTSW 2 160,850,312 (GRCm39) missense probably benign 0.07
R7431:Chd6 UTSW 2 160,868,248 (GRCm39) missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160,791,923 (GRCm39) missense probably damaging 1.00
R7509:Chd6 UTSW 2 160,855,074 (GRCm39) missense probably damaging 1.00
R7699:Chd6 UTSW 2 160,867,863 (GRCm39) missense probably benign 0.13
R7748:Chd6 UTSW 2 160,808,539 (GRCm39) missense probably benign 0.37
R7785:Chd6 UTSW 2 160,812,095 (GRCm39) missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8261:Chd6 UTSW 2 160,799,002 (GRCm39) missense probably damaging 1.00
R8317:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8388:Chd6 UTSW 2 160,861,571 (GRCm39) missense probably damaging 1.00
R8865:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8867:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8996:Chd6 UTSW 2 160,823,543 (GRCm39) missense probably damaging 1.00
R9091:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9270:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9310:Chd6 UTSW 2 160,881,181 (GRCm39) missense probably damaging 1.00
R9438:Chd6 UTSW 2 160,799,078 (GRCm39) missense probably benign 0.01
R9756:Chd6 UTSW 2 160,802,259 (GRCm39) missense probably benign
Z1088:Chd6 UTSW 2 160,808,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGAATGTAGGCAGGTAGC -3'
(R):5'- TCCCTCCTAAAATGAGGCATAG -3'

Sequencing Primer
(F):5'- AAACTTGTCAGTCCTCAGGG -3'
(R):5'- CCTCCTAAAATGAGGCATAGGTATTG -3'
Posted On 2022-04-18