Incidental Mutation 'R8338:Chd1'
ID644769
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8338 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15769980 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1598 (Y1598C)
Ref Sequence ENSEMBL: ENSMUSP00000024627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627]
Predicted Effect probably damaging
Transcript: ENSMUST00000024627
AA Change: Y1598C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: Y1598C

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T C 5: 137,291,744 L445P probably damaging Het
Agrn G A 4: 156,168,561 T1773I probably benign Het
Arap3 A G 18: 37,973,630 S1387P probably damaging Het
Bcl11a G C 11: 24,164,578 K640N probably damaging Het
Bicd1 G A 6: 149,513,123 V445I probably benign Het
C2cd6 A C 1: 59,060,575 N402K probably benign Het
Celsr3 C T 9: 108,827,340 Q341* probably null Het
Cers1 A G 8: 70,331,122 E240G possibly damaging Het
Cfap157 G T 2: 32,778,006 T441N possibly damaging Het
Cfap44 G A 16: 44,419,335 probably null Het
Ckap2l T G 2: 129,285,019 Q413P probably damaging Het
Cobl T C 11: 12,253,696 E1002G probably benign Het
Cryge G A 1: 65,048,774 T156M unknown Het
Cubn A C 2: 13,430,847 F1099L probably benign Het
Cyp7b1 T C 3: 18,097,566 E161G probably benign Het
Dnah10 A G 5: 124,832,502 E4452G probably damaging Het
Dnah2 C T 11: 69,487,296 R1273Q probably damaging Het
Dnah3 T C 7: 120,071,881 E593G probably benign Het
Dnah9 C A 11: 65,841,241 probably null Het
Dnajc22 C A 15: 99,101,141 P69Q probably benign Het
Fam171a2 T A 11: 102,438,346 D529V probably benign Het
Fbxl17 T C 17: 63,356,758 I579V possibly damaging Het
Fry C T 5: 150,359,051 T347M probably damaging Het
Gm13272 A C 4: 88,780,127 D93A probably benign Het
Gm428 T A 4: 73,687,198 M282K possibly damaging Het
Gm4778 A G 3: 94,265,978 I94V possibly damaging Het
Grm4 A T 17: 27,435,003 F658I probably damaging Het
Hmcn1 G A 1: 150,738,734 T1307I probably benign Het
Igkv12-98 G A 6: 68,571,175 S96N probably benign Het
Il2ra A T 2: 11,683,074 T222S probably benign Het
Il5ra G T 6: 106,712,389 T414K probably benign Het
Isg15 T A 4: 156,199,631 I147F probably benign Het
Kif14 C A 1: 136,494,678 A902E probably damaging Het
Lcat G A 8: 105,940,087 R268C probably damaging Het
Lipa T C 19: 34,494,077 N366S probably benign Het
Lrp4 A G 2: 91,492,368 T1101A probably benign Het
Man1a T A 10: 53,925,547 probably null Het
Mib1 A G 18: 10,726,372 D23G probably benign Het
Morc2b A T 17: 33,136,413 M795K probably benign Het
Mycbp2 T A 14: 103,135,265 E4048D probably damaging Het
Myo7b A G 18: 31,971,355 S1447P probably damaging Het
Myt1 A T 2: 181,801,862 T536S possibly damaging Het
Nod1 A T 6: 54,943,971 L454Q probably damaging Het
Nrf1 T A 6: 30,140,248 W199R Het
Olfr1065 A T 2: 86,445,385 M199K probably benign Het
Olfr1490 T A 19: 13,654,852 M141K possibly damaging Het
Olfr301 T C 7: 86,412,494 I44T probably benign Het
Olfr460 T C 6: 40,571,976 F197L probably benign Het
Olfr60 T A 7: 140,345,393 M199L probably benign Het
Ostn G T 16: 27,324,535 A38S probably benign Het
Paxbp1 A T 16: 91,036,547 D266E probably damaging Het
Pcdhb14 G T 18: 37,449,122 G427V probably damaging Het
Pdzrn3 A T 6: 101,150,822 M961K probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Prdx5 T C 19: 6,907,264 D148G probably damaging Het
Ptprj A T 2: 90,471,137 I217N possibly damaging Het
Rccd1 A T 7: 80,320,870 L54Q possibly damaging Het
Rfx6 T A 10: 51,718,094 V370E probably damaging Het
Sdr16c6 C T 4: 4,076,620 C93Y probably damaging Het
Shroom1 A G 11: 53,463,280 D9G probably benign Het
Snrpe A G 1: 133,608,943 V33A probably benign Het
Spats2 T A 15: 99,178,459 D139E probably damaging Het
St18 A G 1: 6,809,292 E405G probably damaging Het
Strap A T 6: 137,741,978 E176V possibly damaging Het
Stxbp5l G T 16: 37,174,356 T729K probably damaging Het
Synj2bp G A 12: 81,504,552 Q97* probably null Het
Tbc1d32 T A 10: 56,028,077 Q1198L possibly damaging Het
Tmem98 T C 11: 80,821,309 S191P probably benign Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Treh A G 9: 44,684,511 N366S probably benign Het
Ttn T G 2: 76,919,792 S3638R probably benign Het
Uggt1 A G 1: 36,227,521 L124P probably damaging Het
Uhrf1bp1 A G 17: 27,876,695 N26S probably damaging Het
V1rd19 A T 7: 24,003,249 K47* probably null Het
Wdhd1 T C 14: 47,268,663 M265V probably benign Het
Wsb1 T C 11: 79,246,277 D168G probably damaging Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7421:Chd1 UTSW 17 15749398 missense probably benign 0.03
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8401:Chd1 UTSW 17 15743211 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCAGCAGCTGTGTGAGG -3'
(R):5'- TCCAACTGCCAATCTGAGAG -3'

Sequencing Primer
(F):5'- AGGTGGCTCTGTGTTGCAC -3'
(R):5'- TCTGAGAGATACCGATAATCCCTGG -3'
Posted On2020-09-02