Mutagenetix > Incidental Mutation

Incidental Mutation 'R8906:Adamts3'

680101

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8906 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 89677716 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1088 (T1088I)

Ref Sequence

ENSEMBL: ENSMUSP00000132219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]

AlphaFold

E9Q287

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061427
AA Change: T1087I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: T1087I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163159
AA Change: T1088I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: T1088I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	C	19: 3,716,686	N91T	possibly damaging	Het
2510009E07Rik	CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA	CCGGA	16: 21,653,398		probably null	Het
4932414N04Rik	A	G	2: 68,732,154	D375G	possibly damaging	Het
4932415D10Rik	T	C	10: 82,286,545	T3544A	probably benign	Het
Adad2	C	A	8: 119,612,986	P69Q	probably benign	Het
Ank2	A	G	3: 126,933,071	V858A	probably benign	Het
Ankrd13a	A	G	5: 114,801,737	N475S	probably benign	Het
Barhl2	G	A	5: 106,455,486	T269I	probably benign	Het
Boc	G	A	16: 44,503,568	R157W		Het
Bsn	G	T	9: 108,107,553	P3101T	unknown	Het
Catsperb	C	A	12: 101,520,645	A477E	possibly damaging	Het
Ccser1	T	A	6: 61,810,858	I220K	probably benign	Het
Cd200r3	A	T	16: 44,957,739	I242F	possibly damaging	Het
Cdc34b	A	C	11: 94,742,085	D37A	probably damaging	Het
Chek2	A	G	5: 110,865,592		probably benign	Het
Cngb1	A	T	8: 95,263,108	V792D	probably damaging	Het
Cops7a	T	C	6: 124,962,408	K93E	possibly damaging	Het
Crispld1	T	C	1: 17,750,771	I345T	possibly damaging	Het
Dgkd	A	G	1: 87,941,435	D1170G	probably damaging	Het
Dhx35	A	G	2: 158,806,998	T115A	possibly damaging	Het
Dnaic1	G	A	4: 41,625,125	R363H	probably benign	Het
Dnmbp	T	A	19: 43,890,242	Q130L	probably benign	Het
Egfr	A	G	11: 16,911,635	Y1138C	probably damaging	Het
Elf3	A	T	1: 135,254,940	L329Q	probably damaging	Het
Enkur	A	G	2: 21,196,757	M39T	probably benign	Het
Epha7	T	C	4: 28,821,615	I260T	probably damaging	Het
Fbxo28	A	T	1: 182,317,069	I310K	probably damaging	Het
Fga	C	A	3: 83,031,804	N495K	probably benign	Het
Galnt6	T	C	15: 100,703,366	D344G	probably damaging	Het
Gm572	A	G	4: 148,666,833	Q221R	probably benign	Het
Gm6205	G	T	5: 94,683,554	R140L	possibly damaging	Het
Gpa33	G	A	1: 166,146,647	A18T	probably benign	Het
Gpatch11	C	T	17: 78,837,860	T6I	probably benign	Het
Gpr84	T	A	15: 103,309,198	S151C	probably damaging	Het
H2-M11	T	A	17: 36,548,959	Y281*	probably null	Het
Hadh	T	C	3: 131,245,242	N155S	probably benign	Het
Hoxd13	A	G	2: 74,669,922	Y269C		Het
Iars	T	A	13: 49,728,701	C1074S	probably benign	Het
Ibtk	G	T	9: 85,743,404	H98N	possibly damaging	Het
Igsf10	C	T	3: 59,326,318	G1665R	probably benign	Het
Inpp5d	A	G	1: 87,697,615		probably benign	Het
Ipo9	A	C	1: 135,394,213	V593G	probably damaging	Het
Irx3	T	C	8: 91,800,287	D263G	possibly damaging	Het
Kif13a	A	G	13: 46,773,678	V1179A	probably benign	Het
Lrrc4c	T	C	2: 97,630,048	Y340H	probably benign	Het
Lysmd1	A	G	3: 95,137,908	D155G	probably damaging	Het
Micalcl	T	A	7: 112,381,464	I105N	probably damaging	Het
Mob2	A	T	7: 142,009,524	L66Q	probably damaging	Het
Myh1	A	G	11: 67,205,913	S337G	probably benign	Het
Neb	T	C	2: 52,206,247	D1002G	probably benign	Het
Nebl	A	T	2: 17,378,117	N116K	probably benign	Het
Nkx2-6	T	C	14: 69,175,174	S264P	probably benign	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Nlrp4e	A	G	7: 23,321,131	T348A	possibly damaging	Het
Nomo1	A	T	7: 46,072,580	I982F	probably benign	Het
Olfr16	A	G	1: 172,956,619		probably benign	Het
Olfr348	A	T	2: 36,786,609	Y28F	probably benign	Het
Olfr739	T	G	14: 50,424,834	F105C	probably damaging	Het
Olfr936	A	G	9: 39,046,781	F213L	possibly damaging	Het
Palld	A	G	8: 61,550,164		probably null	Het
Pcdh7	A	G	5: 57,721,812	Y903C	probably damaging	Het
Pknox2	G	A	9: 36,892,871	T460M	possibly damaging	Het
Ppm1h	C	T	10: 122,878,546	T330I	probably damaging	Het
Ppp2r2b	C	T	18: 42,688,334	R253H	probably damaging	Het
Prr18	G	A	17: 8,341,644	A211T	probably benign	Het
Ptgs2	A	G	1: 150,104,108	I321M		Het
Rara	G	T	11: 98,970,163	R159L	probably damaging	Het
Rasa4	T	A	5: 136,104,592	I635N	probably benign	Het
Rxfp2	A	T	5: 150,066,423	H423L	possibly damaging	Het
Scn4b	A	G	9: 45,147,871	I147V	possibly damaging	Het
Scrn3	G	A	2: 73,331,008	V313I	probably benign	Het
Scrn3	C	A	2: 73,331,011	P314T	possibly damaging	Het
Sh2b1	A	G	7: 126,471,120		probably null	Het
Slc26a10	T	C	10: 127,180,590	Q3R	probably benign	Het
Slitrk1	A	G	14: 108,911,707	I524T	probably damaging	Het
Smcp	T	A	3: 92,584,223	N106Y	unknown	Het
St8sia5	G	A	18: 77,248,476	V202M	probably damaging	Het
Stxbp5l	A	T	16: 37,208,164	D512E	probably damaging	Het
Tas1r2	A	G	4: 139,669,735	E795G	probably damaging	Het
Tdrd1	T	A	19: 56,842,713	V320D	probably damaging	Het
Tmem71	T	A	15: 66,532,757	I261L	probably benign	Het
Tns2	T	C	15: 102,111,604	L643P	probably damaging	Het
Upf1	G	A	8: 70,334,165	Q890*	probably null	Het
Usp43	A	T	11: 67,891,481	H370Q	possibly damaging	Het
Vmn1r236	T	A	17: 21,287,094	I158N	possibly damaging	Het
Vmn2r98	T	A	17: 19,066,270	N343K	probably benign	Het
Vwa8	T	C	14: 79,092,375	S1216P	probably benign	Het
Yars	A	C	4: 129,196,954	D97A	probably damaging	Het
Zer1	G	A	2: 30,111,023	H129Y	probably benign	Het
Zfat	C	T	15: 68,084,555	D1143N	possibly damaging	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- GGACGAAGGTGATCAGTCTTTATG -3'
(R):5'- CCATGTTTGGGTGACAAGTCC -3'

Sequencing Primer
(F):5'- AGGAGGATGGCACTGACTCC -3'
(R):5'- CCATATTCTGTCAAATGGAGGTGC -3'

Posted On

2021-08-31