Incidental Mutation 'R9300:Rif1'
ID 704830
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Name replication timing regulatory factor 1
Synonyms 6530403D07Rik, 5730435J01Rik, D2Ertd145e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9300 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 52072832-52122383 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 52111139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 1535 (S1535L)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112693]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112693
AA Change: S1535L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: S1535L

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000125376
Predicted Effect probably benign
Transcript: ENSMUST00000152178
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,825,614 V596I probably benign Het
Acad8 A T 9: 26,977,632 H371Q probably damaging Het
Actn3 G T 19: 4,871,628 R175S probably benign Het
Adamts9 G T 6: 92,887,390 D780E probably benign Het
AK157302 C A 13: 21,495,367 T21K probably benign Het
Ank3 A T 10: 69,871,042 H329L unknown Het
Ankrd36 A G 11: 5,569,979 H18R possibly damaging Het
Anks1b T A 10: 90,577,104 V38D possibly damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Arid1b C A 17: 5,242,999 P731T probably damaging Het
Atp1a4 A G 1: 172,239,831 F578S probably damaging Het
Atp6v0a2 A T 5: 124,712,248 I360F probably damaging Het
Bcas3 A T 11: 85,557,358 I600F probably damaging Het
C1qtnf7 T G 5: 43,609,099 C20W possibly damaging Het
Cadm1 A T 9: 47,797,523 K184* probably null Het
Ccdc138 A T 10: 58,507,626 H101L probably benign Het
Cep120 T A 18: 53,719,297 N503I probably damaging Het
Chil4 T C 3: 106,202,558 T380A probably benign Het
Clip2 A G 5: 134,498,088 probably null Het
Cyhr1 C A 15: 76,646,341 V260L probably benign Het
Cyp3a11 G A 5: 145,862,354 P341L possibly damaging Het
Cyp3a41a G C 5: 145,720,096 probably benign Het
Dcaf1 A G 9: 106,847,843 I509M possibly damaging Het
Dcaf13 T C 15: 39,146,707 S429P probably damaging Het
Eln A G 5: 134,729,366 V151A unknown Het
Endou T G 15: 97,713,073 M377L probably benign Het
Etfa A G 9: 55,488,868 I138T probably damaging Het
Fbxw10 T A 11: 62,877,283 S982T probably benign Het
Gm9602 A T 14: 4,777,288 R47* probably null Het
Hectd4 G A 5: 121,348,889 V3316I probably benign Het
Hif1a T C 12: 73,940,528 L477S probably benign Het
Icam5 G C 9: 21,035,550 G458A probably benign Het
Itm2b A T 14: 73,366,456 D106E probably benign Het
Kdelc1 A G 1: 44,117,202 I75T possibly damaging Het
Kdm4d G A 9: 14,464,040 T174M probably damaging Het
Kif16b G T 2: 142,699,287 D1364E probably benign Het
Lbhd1 G A 19: 8,884,186 V61M probably damaging Het
Lclat1 T A 17: 73,239,924 S279T probably benign Het
Lhx4 G A 1: 155,705,210 L190F probably damaging Het
Lima1 C T 15: 99,806,439 S283N probably benign Het
Magi1 C A 6: 93,747,228 D496Y probably damaging Het
Map1a T C 2: 121,302,965 S1421P probably damaging Het
Map3k20 C T 2: 72,371,913 H163Y probably damaging Het
Mier3 T G 13: 111,686,356 probably null Het
Mllt3 G A 4: 87,774,047 Q560* probably null Het
Mmp25 T A 17: 23,632,754 D327V probably benign Het
Nckap5 G A 1: 125,981,686 Q1603* probably null Het
Nell1 G A 7: 50,062,620 V63I probably benign Het
Olfr119 C T 17: 37,700,924 P85S probably damaging Het
Olfr151 A C 9: 37,730,282 S234A probably benign Het
Olfr701 A T 7: 106,818,904 I274F probably benign Het
Pde12 C T 14: 26,665,776 E526K probably damaging Het
Pfn4 T C 12: 4,775,442 V93A possibly damaging Het
Ppp2r3d A G 9: 124,423,977 S60P unknown Het
Prelp T C 1: 133,914,519 H296R probably damaging Het
Prickle1 T C 15: 93,500,868 E693G possibly damaging Het
Rars A G 11: 35,815,661 L477P probably damaging Het
Rasal1 G A 5: 120,664,107 R328H probably damaging Het
Rasef A G 4: 73,741,156 F220S probably benign Het
Rnf17 T C 14: 56,460,038 I463T possibly damaging Het
Ryr3 A T 2: 112,860,350 D1138E probably benign Het
Scn9a T A 2: 66,504,892 Y1251F probably benign Het
Sdk2 A G 11: 113,825,030 W1568R possibly damaging Het
Senp6 A G 9: 80,142,151 E1019G probably damaging Het
Shh A G 5: 28,458,463 Y236H probably damaging Het
Sin3a A G 9: 57,107,460 D655G probably damaging Het
Slc35a4 C T 18: 36,682,221 P35S probably damaging Het
Slc35g1 T C 19: 38,396,185 L24P probably benign Het
Slc39a4 G T 15: 76,614,559 Q312K probably damaging Het
Slc6a5 A T 7: 49,951,427 I659F probably damaging Het
Slc7a4 T C 16: 17,574,535 Y345C probably benign Het
Slco6c1 G T 1: 97,066,084 R645S probably benign Het
Soat1 T C 1: 156,441,353 Y209C probably benign Het
Tbc1d9b T C 11: 50,163,887 S953P probably benign Het
Tgm1 G A 14: 55,704,846 H683Y probably benign Het
Tmem98 G A 11: 80,817,606 R134Q probably damaging Het
Trpm3 A C 19: 22,978,381 M1107L possibly damaging Het
Vmn1r11 G A 6: 57,137,887 V179I probably benign Het
Vmn1r119 G T 7: 21,011,713 T248K probably damaging Het
Vmn1r236 T A 17: 21,286,683 I21N possibly damaging Het
Vmn2r24 A G 6: 123,816,071 T786A possibly damaging Het
Vstm5 A T 9: 15,257,289 I50F probably damaging Het
Wdr1 T C 5: 38,527,912 D572G probably damaging Het
Xaf1 T C 11: 72,301,691 F5S probably benign Het
Zan A T 5: 137,470,257 probably null Het
Zfp697 T C 3: 98,427,663 V248A possibly damaging Het
Zkscan3 T A 13: 21,393,497 T249S unknown Het
Znfx1 A G 2: 167,055,940 Y355H probably damaging Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52121007 missense probably damaging 0.96
IGL00711:Rif1 APN 2 52111070 missense probably benign 0.00
IGL00721:Rif1 APN 2 52119117 missense probably damaging 1.00
IGL01085:Rif1 APN 2 52085140 missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52095948 missense probably damaging 1.00
IGL01107:Rif1 APN 2 52111303 missense probably benign 0.00
IGL01138:Rif1 APN 2 52111522 missense probably damaging 1.00
IGL01844:Rif1 APN 2 52112543 missense probably benign 0.07
IGL02441:Rif1 APN 2 52105515 missense probably benign 0.00
IGL02448:Rif1 APN 2 52116696 missense probably damaging 0.99
IGL02563:Rif1 APN 2 52077065 missense probably damaging 1.00
IGL02704:Rif1 APN 2 52093576 missense probably damaging 1.00
IGL02946:Rif1 APN 2 52110125 nonsense probably null
IGL03060:Rif1 APN 2 52112137 missense probably damaging 0.97
IGL03206:Rif1 APN 2 52103622 missense probably damaging 1.00
IGL03263:Rif1 APN 2 52090261 missense probably damaging 0.99
IGL03267:Rif1 APN 2 52076988 missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52112599 missense probably benign 0.32
hifi UTSW 2 52110324 unclassified probably benign
nietzsche UTSW 2 52077020 missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52111958 missense
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0104:Rif1 UTSW 2 52110092 missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52090286 critical splice donor site probably null
R0276:Rif1 UTSW 2 52110324 unclassified probably benign
R0278:Rif1 UTSW 2 52110324 unclassified probably benign
R0288:Rif1 UTSW 2 52110013 missense probably damaging 1.00
R0314:Rif1 UTSW 2 52110324 unclassified probably benign
R0345:Rif1 UTSW 2 52110324 unclassified probably benign
R0346:Rif1 UTSW 2 52110324 unclassified probably benign
R0383:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R0384:Rif1 UTSW 2 52110324 unclassified probably benign
R0387:Rif1 UTSW 2 52110324 unclassified probably benign
R0388:Rif1 UTSW 2 52110324 unclassified probably benign
R0456:Rif1 UTSW 2 52110324 unclassified probably benign
R0477:Rif1 UTSW 2 52110324 unclassified probably benign
R0505:Rif1 UTSW 2 52110737 missense probably damaging 0.99
R0510:Rif1 UTSW 2 52110324 unclassified probably benign
R0511:Rif1 UTSW 2 52110324 unclassified probably benign
R0512:Rif1 UTSW 2 52110324 unclassified probably benign
R0633:Rif1 UTSW 2 52112563 missense probably benign 0.00
R0637:Rif1 UTSW 2 52110324 unclassified probably benign
R0638:Rif1 UTSW 2 52111588 missense probably benign 0.12
R0666:Rif1 UTSW 2 52110324 unclassified probably benign
R0675:Rif1 UTSW 2 52110324 unclassified probably benign
R0707:Rif1 UTSW 2 52110324 unclassified probably benign
R0726:Rif1 UTSW 2 52110353 missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52110324 unclassified probably benign
R0744:Rif1 UTSW 2 52110324 unclassified probably benign
R0938:Rif1 UTSW 2 52110324 unclassified probably benign
R0939:Rif1 UTSW 2 52110324 unclassified probably benign
R0940:Rif1 UTSW 2 52110324 unclassified probably benign
R0941:Rif1 UTSW 2 52110324 unclassified probably benign
R0942:Rif1 UTSW 2 52110324 unclassified probably benign
R0943:Rif1 UTSW 2 52110324 unclassified probably benign
R1006:Rif1 UTSW 2 52085029 missense probably damaging 0.99
R1052:Rif1 UTSW 2 52111562 missense probably benign 0.01
R1061:Rif1 UTSW 2 52110324 unclassified probably benign
R1175:Rif1 UTSW 2 52107628 unclassified probably benign
R1183:Rif1 UTSW 2 52110324 unclassified probably benign
R1184:Rif1 UTSW 2 52110324 unclassified probably benign
R1271:Rif1 UTSW 2 52110324 unclassified probably benign
R1332:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1336:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1351:Rif1 UTSW 2 52111555 missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52110324 unclassified probably benign
R1527:Rif1 UTSW 2 52110324 unclassified probably benign
R1560:Rif1 UTSW 2 52111131 missense probably damaging 1.00
R1563:Rif1 UTSW 2 52073223 missense probably damaging 0.99
R1571:Rif1 UTSW 2 52110324 unclassified probably benign
R1625:Rif1 UTSW 2 52103640 missense probably benign 0.25
R1679:Rif1 UTSW 2 52110324 unclassified probably benign
R1689:Rif1 UTSW 2 52110324 unclassified probably benign
R1731:Rif1 UTSW 2 52110324 unclassified probably benign
R1744:Rif1 UTSW 2 52112392 missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52110324 unclassified probably benign
R1748:Rif1 UTSW 2 52110324 unclassified probably benign
R1831:Rif1 UTSW 2 52078495 nonsense probably null
R1902:Rif1 UTSW 2 52116673 missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52098409 missense probably benign 0.01
R1978:Rif1 UTSW 2 52110324 unclassified probably benign
R2000:Rif1 UTSW 2 52081298 missense probably damaging 0.99
R2030:Rif1 UTSW 2 52092346 missense probably damaging 1.00
R2056:Rif1 UTSW 2 52093576 missense probably damaging 1.00
R2106:Rif1 UTSW 2 52110324 unclassified probably benign
R2109:Rif1 UTSW 2 52110324 unclassified probably benign
R2125:Rif1 UTSW 2 52110324 unclassified probably benign
R2126:Rif1 UTSW 2 52110324 unclassified probably benign
R2145:Rif1 UTSW 2 52111400 missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52110324 unclassified probably benign
R2153:Rif1 UTSW 2 52110324 unclassified probably benign
R2213:Rif1 UTSW 2 52110324 unclassified probably benign
R2327:Rif1 UTSW 2 52110324 unclassified probably benign
R2512:Rif1 UTSW 2 52110324 unclassified probably benign
R2513:Rif1 UTSW 2 52110324 unclassified probably benign
R2516:Rif1 UTSW 2 52110324 unclassified probably benign
R2520:Rif1 UTSW 2 52110324 unclassified probably benign
R2905:Rif1 UTSW 2 52098504 missense probably damaging 0.99
R3005:Rif1 UTSW 2 52082764 missense probably damaging 1.00
R3155:Rif1 UTSW 2 52110324 unclassified probably benign
R3156:Rif1 UTSW 2 52110324 unclassified probably benign
R3429:Rif1 UTSW 2 52110324 unclassified probably benign
R3707:Rif1 UTSW 2 52093580 missense probably damaging 1.00
R3907:Rif1 UTSW 2 52112545 missense probably benign 0.03
R3978:Rif1 UTSW 2 52116747 critical splice donor site probably null
R4023:Rif1 UTSW 2 52121087 missense probably benign 0.01
R4052:Rif1 UTSW 2 52098471 nonsense probably null
R4668:Rif1 UTSW 2 52111952 missense probably benign 0.01
R4674:Rif1 UTSW 2 52106942 missense probably null 1.00
R4715:Rif1 UTSW 2 52073139 utr 5 prime probably benign
R4766:Rif1 UTSW 2 52098934 missense probably damaging 1.00
R4783:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4785:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4869:Rif1 UTSW 2 52093611 intron probably benign
R4911:Rif1 UTSW 2 52110518 missense probably damaging 0.98
R4951:Rif1 UTSW 2 52084986 splice site probably null
R5044:Rif1 UTSW 2 52109928 missense probably damaging 0.99
R5088:Rif1 UTSW 2 52092295 missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52120309 missense probably damaging 1.00
R5187:Rif1 UTSW 2 52081289 missense probably damaging 1.00
R5222:Rif1 UTSW 2 52077020 missense probably benign 0.08
R5243:Rif1 UTSW 2 52111824 missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52120971 intron probably benign
R5476:Rif1 UTSW 2 52089595 missense probably damaging 1.00
R5496:Rif1 UTSW 2 52098916 missense probably damaging 1.00
R5641:Rif1 UTSW 2 52121158 missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52105639 critical splice donor site probably null
R5987:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5990:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5992:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6019:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6020:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6255:Rif1 UTSW 2 52085053 missense probably damaging 1.00
R6342:Rif1 UTSW 2 52119156 missense probably damaging 0.97
R6364:Rif1 UTSW 2 52107669 missense probably damaging 0.97
R6747:Rif1 UTSW 2 52078263 splice site probably null
R6928:Rif1 UTSW 2 52095961 missense probably damaging 1.00
R6954:Rif1 UTSW 2 52112691 missense probably benign 0.00
R7003:Rif1 UTSW 2 52076989 missense probably benign 0.06
R7310:Rif1 UTSW 2 52105619 missense probably benign 0.12
R7549:Rif1 UTSW 2 52078507 missense possibly damaging 0.52
R7603:Rif1 UTSW 2 52076175 missense probably damaging 1.00
R7673:Rif1 UTSW 2 52088654 missense probably damaging 1.00
R7741:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R7777:Rif1 UTSW 2 52116356 missense probably benign 0.00
R7910:Rif1 UTSW 2 52078387 nonsense probably null
R7962:Rif1 UTSW 2 52074276 missense probably damaging 1.00
R8264:Rif1 UTSW 2 52090278 missense noncoding transcript
R8390:Rif1 UTSW 2 52110923 missense probably damaging 1.00
R8479:Rif1 UTSW 2 52112551 missense possibly damaging 0.52
R8490:Rif1 UTSW 2 52110999 missense probably damaging 0.96
R8762:Rif1 UTSW 2 52111730 missense
R8785:Rif1 UTSW 2 52110481 missense probably benign 0.06
R8890:Rif1 UTSW 2 52098863 missense probably damaging 0.99
R9081:Rif1 UTSW 2 52110977 missense probably damaging 0.99
R9225:Rif1 UTSW 2 52111850 missense probably benign 0.22
R9284:Rif1 UTSW 2 52108552 missense probably benign 0.00
R9366:Rif1 UTSW 2 52120344 missense
R9477:Rif1 UTSW 2 52111330 missense probably benign 0.02
R9522:Rif1 UTSW 2 52081299 missense probably damaging 1.00
R9573:Rif1 UTSW 2 52110454 missense not run
X0064:Rif1 UTSW 2 52074315 missense probably benign 0.00
X0064:Rif1 UTSW 2 52094633 missense probably damaging 0.96
Z1177:Rif1 UTSW 2 52088648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACCTGAGAGAACTTCAGGGG -3'
(R):5'- AGCCGCTGCATTTACATCAAC -3'

Sequencing Primer
(F):5'- GGAACCCAGTGTTAATGCTGAAATTG -3'
(R):5'- GCTGCATTTACATCAACATCAGG -3'
Posted On 2022-03-25