Incidental Mutation 'R8116:Shprh'
ID631213
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene NameSNF2 histone linker PHD RING helicase
Synonyms2610103K11Rik, D230017O13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8116 (G1)
Quality Score191.009
Status Not validated
Chromosome10
Chromosomal Location11149427-11217595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11213461 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1648 (S1648P)
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541]
Predicted Effect probably damaging
Transcript: ENSMUST00000044053
AA Change: S1648P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: S1648P

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159541
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,091,594 N7K probably benign Het
Akap9 T A 5: 4,061,183 D3081E probably benign Het
Amer2 G A 14: 60,379,405 A350T probably damaging Het
Amotl1 A G 9: 14,555,572 probably null Het
Ankib1 A T 5: 3,702,995 V651E probably damaging Het
Aox1 T C 1: 58,076,124 V756A probably damaging Het
Arap2 A C 5: 62,730,611 I464S probably benign Het
Atp8a2 A C 14: 60,026,208 M359R probably damaging Het
Aunip T C 4: 134,523,307 S188P possibly damaging Het
Cdt1 A G 8: 122,571,989 E455G probably benign Het
Cyp2r1 G T 7: 114,550,355 H475N probably benign Het
Dnah7a G T 1: 53,503,890 H2374N probably benign Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dst G A 1: 34,274,180 A4343T probably benign Het
Efcab3 A G 11: 105,111,851 D304G possibly damaging Het
Efcc1 T C 6: 87,751,790 L409P probably damaging Het
Eno1 G T 4: 150,241,069 S37I probably damaging Het
Ermp1 A T 19: 29,623,796 L517Q probably damaging Het
Farp1 T G 14: 121,233,820 I196S probably damaging Het
Fbxo21 A G 5: 117,990,854 T310A possibly damaging Het
Fbxo31 C T 8: 121,560,388 V149M probably damaging Het
Ggcx C A 6: 72,429,528 T658N possibly damaging Het
Gm884 A T 11: 103,543,289 M3018K unknown Het
Gpc5 A C 14: 115,399,225 H440P probably damaging Het
H13 C T 2: 152,695,526 A297V probably damaging Het
H2-DMb1 T A 17: 34,155,469 L31Q probably damaging Het
Ifi207 G A 1: 173,730,180 P331S unknown Het
Il11ra1 G T 4: 41,766,251 A263S probably benign Het
Il1a C A 2: 129,302,944 V185F probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Kdm4d T A 9: 14,463,941 K207M probably damaging Het
Lrrc4b T C 7: 44,461,109 L135P probably damaging Het
Lrrk1 A G 7: 66,262,623 Y1730H possibly damaging Het
Mcpt2 C A 14: 56,042,206 A18D probably damaging Het
Mtmr4 C T 11: 87,611,930 R937* probably null Het
Muc16 T A 9: 18,658,737 T829S unknown Het
Mum1 G A 10: 80,240,397 G474S probably damaging Het
Myof A C 19: 37,932,719 I1365S probably damaging Het
Npc2 C T 12: 84,760,838 R82Q probably benign Het
Olfr1123 T A 2: 87,418,737 S228T probably damaging Het
Olfr117 G A 17: 37,659,740 L198F probably damaging Het
Olfr1295 T C 2: 111,565,438 D2G probably benign Het
Olfr418 T A 1: 173,270,480 F102I possibly damaging Het
Olfr918 A T 9: 38,673,168 I92N possibly damaging Het
Olfr926 T A 9: 38,877,730 S185T probably damaging Het
Olfr934 A T 9: 38,982,873 M57K probably damaging Het
Pdzph1 T C 17: 58,975,143 N48S probably benign Het
Plce1 A T 19: 38,524,818 H187L probably benign Het
Pramel6 G T 2: 87,508,464 V3F probably benign Het
Prr5l CCTCGCTCGCTCGCTCGC CCTCGCTCGCTCGC 2: 101,797,574 probably null Het
Rabgap1l A G 1: 160,702,442 Y358H probably benign Het
Rbbp8 T C 18: 11,722,670 S625P probably damaging Het
Rhot1 A T 11: 80,251,053 K461I probably benign Het
Rpa1 G A 11: 75,302,675 T610I possibly damaging Het
Ryr1 G T 7: 29,110,883 H316N probably benign Het
Sipa1 A T 19: 5,652,112 D923E possibly damaging Het
Spata6 A G 4: 111,828,320 Y474C possibly damaging Het
Sptbn1 A T 11: 30,139,117 I715N probably damaging Het
Stab1 A T 14: 31,158,953 D627E possibly damaging Het
Stard9 T A 2: 120,664,939 C98* probably null Het
Tfpi2 T C 6: 3,963,872 T187A probably damaging Het
Tmem63a G T 1: 180,960,483 K267N probably benign Het
Topaz1 C T 9: 122,775,643 A1104V probably benign Het
Trmt11 A G 10: 30,566,494 I231T possibly damaging Het
Utp15 G A 13: 98,250,863 T401I probably benign Het
Vmn2r13 T C 5: 109,175,060 K121R probably benign Het
Xab2 C T 8: 3,613,830 R363H probably damaging Het
Zfand2b T A 1: 75,168,860 F3L possibly damaging Het
Zfyve28 A T 5: 34,217,600 S357T probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 splice site probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8759:Shprh UTSW 10 11157164 missense possibly damaging 0.92
R8937:Shprh UTSW 10 11185437 missense possibly damaging 0.60
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAACCTGCTTGACAACAGTTG -3'
(R):5'- GGAACCAATTGCCAATTATTACTAGGC -3'

Sequencing Primer
(F):5'- AGCATTTTCTGACAAAGCTTCAG -3'
(R):5'- AATTGCCAATTATTACTAGGCTAGAG -3'
Posted On2020-06-30