Mutagenetix > Incidental Mutation

Incidental Mutation 'R9457:Trrap'

714642

Institutional Source

Beutler Lab

Gene Symbol

Trrap

Ensembl Gene

ENSMUSG00000045482

Gene Name

transformation/transcription domain-associated protein

Synonyms

transactivation/transformation-domain associated protein

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9457 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

144767732-144859778 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 144826668 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 2457 (Y2457N)

Ref Sequence

ENSEMBL: ENSMUSP00000098035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000038980
AA Change: Y2457N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: Y2457N

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3363	3376	N/A	INTRINSIC
low complexity region	3407	3418	N/A	INTRINSIC
PI3Kc	3509	3798	5.11e-8	SMART
FATC	3797	3829	1.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000094120
AA Change: Y2475N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: Y2475N

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1682	2e-6	SMART
low complexity region	1850	1861	N/A	INTRINSIC
low complexity region	1884	1899	N/A	INTRINSIC
low complexity region	2307	2321	N/A	INTRINSIC
Pfam:FAT	2848	3203	1.1e-68	PFAM
low complexity region	3392	3405	N/A	INTRINSIC
low complexity region	3436	3447	N/A	INTRINSIC
PI3Kc	3538	3827	5.11e-8	SMART
FATC	3826	3858	1.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100467
AA Change: Y2457N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: Y2457N

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3381	3394	N/A	INTRINSIC
low complexity region	3425	3436	N/A	INTRINSIC
PI3Kc	3527	3816	5.11e-8	SMART
FATC	3815	3847	1.89e-3	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: Y2196N

Domain	Start	End	E-Value	Type
low complexity region	197	242	N/A	INTRINSIC
low complexity region	244	255	N/A	INTRINSIC
SCOP:d1gw5a_	474	1003	9e-7	SMART
Blast:PI3Kc	480	579	1e-13	BLAST
low complexity region	1083	1092	N/A	INTRINSIC
low complexity region	1572	1583	N/A	INTRINSIC
low complexity region	1606	1621	N/A	INTRINSIC
low complexity region	2029	2043	N/A	INTRINSIC
Pfam:FAT	2570	2914	1.5e-69	PFAM
low complexity region	3121	3134	N/A	INTRINSIC
low complexity region	3165	3176	N/A	INTRINSIC
PI3Kc	3267	3556	5.11e-8	SMART
FATC	3555	3587	1.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000213013
AA Change: Y2476N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	A	G	18: 12,179,246	H181R	probably benign	Het
4930404N11Rik	C	A	10: 81,365,777	V4L	probably benign	Het
4930430A15Rik	A	T	2: 111,170,286	M196K	unknown	Het
4932415D10Rik	A	G	10: 82,286,739	V3479A	probably benign	Het
A930009A15Rik	T	C	10: 115,578,331	L54P	unknown	Het
Ablim3	A	G	18: 61,845,849	S204P	probably benign	Het
Acadl	A	G	1: 66,853,241	V141A	probably benign	Het
Ace3	A	G	11: 105,994,861	D31G	probably benign	Het
Adam11	T	G	11: 102,769,898	V85G	probably benign	Het
Adarb1	A	T	10: 77,322,148	M155K	possibly damaging	Het
Arhgap10	G	A	8: 77,384,786	T376M	probably benign	Het
Bod1l	G	T	5: 41,821,967	T668K	probably damaging	Het
Ccdc87	A	G	19: 4,841,631	E717G	probably damaging	Het
Cdh17	T	A	4: 11,771,329	I37N	probably damaging	Het
Cfap99	T	G	5: 34,301,397	F45L	probably benign	Het
Chsy1	C	A	7: 66,172,400	H794Q	probably benign	Het
Clec4a3	G	A	6: 122,954,086	V45I	probably benign	Het
Clic3	G	A	2: 25,457,718	V32I	probably benign	Het
Clip2	A	T	5: 134,502,730	D740E	probably benign	Het
Col5a2	C	T	1: 45,386,844	V1062I	probably benign	Het
Col5a2	A	G	1: 45,392,813		probably null	Het
Cyp2j11	C	T	4: 96,307,359	V367I	probably damaging	Het
Ddr1	C	T	17: 35,682,758	A821T	possibly damaging	Het
Dna2	G	A	10: 62,950,793	E107K	probably benign	Het
Eif3d	A	G	15: 77,959,694	V484A	probably benign	Het
Fgfr4	A	G	13: 55,161,127	T354A	probably benign	Het
Fkbp6	T	C	5: 135,349,632	D54G	probably benign	Het
Gm4787	T	A	12: 81,379,246	E46V	probably damaging	Het
Gm47995	A	G	1: 151,198,475	T10A	possibly damaging	Het
Gm498	T	C	7: 143,883,976	V137A	possibly damaging	Het
Gnb1l	T	A	16: 18,540,995	I50N	probably damaging	Het
Gphb5	A	T	12: 75,415,749	V22D	probably damaging	Het
Gstt4	C	T	10: 75,815,125	C221Y	probably benign	Het
Hmces	T	C	6: 87,933,274	V222A	possibly damaging	Het
Kat14	T	A	2: 144,373,782	D62E	probably benign	Het
Kcnmb2	T	A	3: 32,181,869	V89E	probably benign	Het
Kif23	T	A	9: 61,944,225	N63I	probably benign	Het
Lamc2	T	C	1: 153,139,854	M578V	probably benign	Het
Ltbp2	A	T	12: 84,789,153	C1335S	probably benign	Het
Lyst	A	G	13: 13,687,745	E2622G	possibly damaging	Het
Mctp1	A	T	13: 76,384,674	H47L	probably benign	Het
Micalcl	A	G	7: 112,411,458	K618R	probably damaging	Het
Mllt6	T	C	11: 97,665,760	I92T	probably benign	Het
Morc2a	A	G	11: 3,676,184	I223V	probably benign	Het
Msh3	A	T	13: 92,345,086	I306N	probably benign	Het
Myo3b	T	A	2: 70,095,209	S35T	probably benign	Het
Nfkbiz	A	T	16: 55,813,984	V700E	probably damaging	Het
Oit3	T	A	10: 59,441,683	M1L	unknown	Het
Olfr1048	A	T	2: 86,236,472	I114K	probably damaging	Het
Olfr1231	A	T	2: 89,302,731	I287N	probably damaging	Het
Olfr606	T	A	7: 103,451,411	F25I	probably benign	Het
Peg3	T	G	7: 6,707,999	D1408A	probably damaging	Het
Plaa	A	C	4: 94,586,883	S201R	possibly damaging	Het
Psmd5	A	G	2: 34,854,326	S395P	probably benign	Het
Ralgapa2	T	C	2: 146,334,554	I1701V	probably damaging	Het
Rnf32	G	A	5: 29,206,186	A157T	probably damaging	Het
Rrad	T	A	8: 104,629,727		probably null	Het
Samm50	T	A	15: 84,207,841	L339Q	probably damaging	Het
Scin	T	C	12: 40,104,958	E212G	possibly damaging	Het
Scrib	T	C	15: 76,067,299	D146G	probably damaging	Het
Slc19a1	G	A	10: 77,049,771	D502N	probably benign	Het
Slc4a4	T	C	5: 89,214,573	S839P	probably damaging	Het
Slc4a8	A	G	15: 100,806,260	D764G	probably damaging	Het
Slc6a19	G	A	13: 73,681,765	A590V	probably damaging	Het
Slfn8	G	T	11: 83,017,706	H4N	probably benign	Het
Smad9	T	A	3: 54,789,335	F274I	possibly damaging	Het
Snx4	A	G	16: 33,286,010	E271G	probably benign	Het
Thap4	G	A	1: 93,750,306	R253*	probably null	Het
Tmem65	T	A	15: 58,790,179	I144F		Het
Tnrc6a	G	A	7: 123,179,735	R1223Q	probably benign	Het
Traf7	CA	CAA	17: 24,527,763		probably benign	Het
Trpm2	T	C	10: 77,911,392	Y1424C	possibly damaging	Het
Vmn1r7	A	G	6: 57,024,523	S251P	probably damaging	Het
Vmn2r89	A	T	14: 51,456,012	E273V	probably damaging	Het
Vps52	A	G	17: 33,962,182	D466G	probably damaging	Het
Xirp2	T	C	2: 67,515,632	V2739A	probably benign	Het
Zc3h4	C	T	7: 16,434,750	S1003F	unknown	Het
Zyg11a	A	T	4: 108,217,905	H6Q	probably damaging	Het

Other mutations in Trrap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Trrap	APN	5	144779974	splice site	probably benign
IGL00470:Trrap	APN	5	144818038	missense	probably damaging	1.00
IGL00490:Trrap	APN	5	144825225	missense	probably benign	0.40
IGL01072:Trrap	APN	5	144784255	splice site	probably benign
IGL01087:Trrap	APN	5	144846539	missense	probably damaging	0.99
IGL01300:Trrap	APN	5	144804818	missense	probably damaging	1.00
IGL01350:Trrap	APN	5	144830969	missense	possibly damaging	0.92
IGL01410:Trrap	APN	5	144831021	missense	probably benign	0.00
IGL01571:Trrap	APN	5	144833287	splice site	probably benign
IGL01748:Trrap	APN	5	144833340	missense	probably damaging	1.00
IGL01839:Trrap	APN	5	144821875	missense	probably damaging	1.00
IGL01976:Trrap	APN	5	144856989	missense	probably benign	0.00
IGL02075:Trrap	APN	5	144828494	missense	probably benign	0.00
IGL02127:Trrap	APN	5	144816433	missense	probably benign	0.22
IGL02131:Trrap	APN	5	144840436	missense	probably damaging	1.00
IGL02287:Trrap	APN	5	144832538	missense	probably damaging	1.00
IGL02301:Trrap	APN	5	144777917	missense	probably benign	0.05
IGL02336:Trrap	APN	5	144798390	missense	probably benign	0.39
IGL02526:Trrap	APN	5	144824550	missense	probably benign	0.00
IGL02873:Trrap	APN	5	144841079	splice site	probably benign
IGL02953:Trrap	APN	5	144815964	missense	probably damaging	0.99
IGL03404:Trrap	APN	5	144833186	missense	probably benign	0.00
Buffer	UTSW	5	144834204	missense	probably benign	0.06
Card-tower	UTSW	5	144804766	missense	probably damaging	1.00
Cookie	UTSW	5	144794049	missense	probably damaging	1.00
Glass_house	UTSW	5	144845477	missense	possibly damaging	0.67
Immovable	UTSW	5	144790855	missense	possibly damaging	0.66
R5049_trrap_520	UTSW	5	144826717	missense	probably damaging	1.00
R7167_Trrap_977	UTSW	5	144839614	missense	probably benign	0.39
vitreous	UTSW	5	144805727	missense	probably damaging	1.00
PIT4243001:Trrap	UTSW	5	144796971	missense	probably benign	0.00
PIT4466001:Trrap	UTSW	5	144828600	missense	probably benign	0.02
R0062:Trrap	UTSW	5	144782193	splice site	probably benign
R0062:Trrap	UTSW	5	144782193	splice site	probably benign
R0112:Trrap	UTSW	5	144822761	nonsense	probably null
R0126:Trrap	UTSW	5	144805750	nonsense	probably null
R0257:Trrap	UTSW	5	144804235	missense	probably benign	0.31
R0325:Trrap	UTSW	5	144816395	missense	probably benign	0.05
R0376:Trrap	UTSW	5	144816339	missense	probably benign	0.03
R0396:Trrap	UTSW	5	144814556	missense	probably damaging	0.99
R0448:Trrap	UTSW	5	144839567	missense	possibly damaging	0.66
R0454:Trrap	UTSW	5	144846477	missense	probably damaging	1.00
R0711:Trrap	UTSW	5	144853499	missense	probably damaging	1.00
R0827:Trrap	UTSW	5	144814830	missense	probably benign	0.00
R1005:Trrap	UTSW	5	144805727	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144804766	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144804766	missense	probably damaging	1.00
R1179:Trrap	UTSW	5	144777939	missense	possibly damaging	0.94
R1218:Trrap	UTSW	5	144816409	missense	probably damaging	1.00
R1264:Trrap	UTSW	5	144789599	splice site	probably benign
R1374:Trrap	UTSW	5	144846618	missense	probably damaging	1.00
R1401:Trrap	UTSW	5	144857422	missense	possibly damaging	0.93
R1480:Trrap	UTSW	5	144818313	missense	probably benign
R1538:Trrap	UTSW	5	144837202	missense	possibly damaging	0.65
R1751:Trrap	UTSW	5	144814575	critical splice donor site	probably null
R1779:Trrap	UTSW	5	144828590	missense	probably benign	0.01
R1782:Trrap	UTSW	5	144822703	missense	possibly damaging	0.93
R1792:Trrap	UTSW	5	144853586	missense	possibly damaging	0.87
R1859:Trrap	UTSW	5	144830951	missense	probably benign	0.04
R1861:Trrap	UTSW	5	144815917	splice site	probably null
R1902:Trrap	UTSW	5	144816053	missense	probably damaging	1.00
R1903:Trrap	UTSW	5	144816053	missense	probably damaging	1.00
R2021:Trrap	UTSW	5	144853488	missense	possibly damaging	0.94
R2026:Trrap	UTSW	5	144803044	missense	possibly damaging	0.86
R2036:Trrap	UTSW	5	144828562	missense	probably benign	0.08
R2099:Trrap	UTSW	5	144782239	missense	possibly damaging	0.46
R2108:Trrap	UTSW	5	144825874	missense	probably benign	0.01
R2113:Trrap	UTSW	5	144844211	missense	probably damaging	1.00
R2174:Trrap	UTSW	5	144821855	missense	probably benign	0.40
R2442:Trrap	UTSW	5	144817966	missense	probably damaging	1.00
R2568:Trrap	UTSW	5	144843369	critical splice donor site	probably null
R3442:Trrap	UTSW	5	144792252	missense	probably benign	0.03
R3853:Trrap	UTSW	5	144792165	missense	probably damaging	1.00
R4401:Trrap	UTSW	5	144843318	missense	possibly damaging	0.60
R4493:Trrap	UTSW	5	144831048	missense	probably benign	0.21
R4524:Trrap	UTSW	5	144825321	missense	probably benign	0.38
R4569:Trrap	UTSW	5	144792118	missense	probably benign	0.13
R4672:Trrap	UTSW	5	144785480	missense	probably damaging	0.97
R4732:Trrap	UTSW	5	144816570	missense	probably damaging	1.00
R4733:Trrap	UTSW	5	144816570	missense	probably damaging	1.00
R4791:Trrap	UTSW	5	144803277	missense	probably damaging	1.00
R4795:Trrap	UTSW	5	144832488	missense	probably benign	0.06
R4827:Trrap	UTSW	5	144800948	missense	probably benign	0.02
R4839:Trrap	UTSW	5	144845592	missense	probably damaging	1.00
R4915:Trrap	UTSW	5	144805735	missense	probably damaging	0.99
R4951:Trrap	UTSW	5	144805720	missense	possibly damaging	0.65
R4959:Trrap	UTSW	5	144856960	missense	probably damaging	1.00
R5049:Trrap	UTSW	5	144826717	missense	probably damaging	1.00
R5074:Trrap	UTSW	5	144851179	missense	probably damaging	1.00
R5236:Trrap	UTSW	5	144817786	missense	probably benign	0.07
R5281:Trrap	UTSW	5	144813503	missense	probably benign	0.13
R5322:Trrap	UTSW	5	144844224	missense	probably damaging	1.00
R5457:Trrap	UTSW	5	144849977	missense	probably damaging	1.00
R5590:Trrap	UTSW	5	144782265	missense	probably benign	0.05
R5799:Trrap	UTSW	5	144830945	missense	probably benign
R5885:Trrap	UTSW	5	144794793	missense	probably damaging	1.00
R5905:Trrap	UTSW	5	144849920	missense	possibly damaging	0.95
R5908:Trrap	UTSW	5	144786708	missense	probably damaging	0.96
R5956:Trrap	UTSW	5	144807391	splice site	silent
R5992:Trrap	UTSW	5	144810184	missense	probably benign	0.00
R6017:Trrap	UTSW	5	144844241	missense	probably damaging	1.00
R6029:Trrap	UTSW	5	144817679	missense	possibly damaging	0.94
R6029:Trrap	UTSW	5	144825914	missense	possibly damaging	0.75
R6117:Trrap	UTSW	5	144802961	missense	possibly damaging	0.78
R6166:Trrap	UTSW	5	144781981	missense	possibly damaging	0.66
R6234:Trrap	UTSW	5	144839713	splice site	probably null
R6288:Trrap	UTSW	5	144811992	missense	probably damaging	1.00
R6290:Trrap	UTSW	5	144805018	missense	probably damaging	1.00
R6316:Trrap	UTSW	5	144813526	missense	probably benign	0.02
R6398:Trrap	UTSW	5	144790870	missense	possibly damaging	0.83
R6413:Trrap	UTSW	5	144784046	missense	possibly damaging	0.83
R6499:Trrap	UTSW	5	144857002	missense	probably damaging	1.00
R6529:Trrap	UTSW	5	144834204	missense	probably benign	0.06
R6574:Trrap	UTSW	5	144815550	critical splice donor site	probably null
R6631:Trrap	UTSW	5	144771650	missense	possibly damaging	0.94
R6727:Trrap	UTSW	5	144856950	missense	probably damaging	1.00
R6776:Trrap	UTSW	5	144851256	nonsense	probably null
R6914:Trrap	UTSW	5	144784043	missense	possibly damaging	0.83
R6942:Trrap	UTSW	5	144784043	missense	possibly damaging	0.83
R6945:Trrap	UTSW	5	144790855	missense	possibly damaging	0.66
R7023:Trrap	UTSW	5	144792154	missense	possibly damaging	0.64
R7107:Trrap	UTSW	5	144797135	missense	probably benign	0.05
R7139:Trrap	UTSW	5	144803178	missense	possibly damaging	0.65
R7148:Trrap	UTSW	5	144821803	missense	possibly damaging	0.77
R7167:Trrap	UTSW	5	144839614	missense	probably benign	0.39
R7171:Trrap	UTSW	5	144794049	missense	probably damaging	1.00
R7205:Trrap	UTSW	5	144842707	missense	possibly damaging	0.94
R7215:Trrap	UTSW	5	144797135	missense	probably benign	0.05
R7255:Trrap	UTSW	5	144858954	missense	probably damaging	1.00
R7261:Trrap	UTSW	5	144845477	missense	possibly damaging	0.67
R7264:Trrap	UTSW	5	144814523	missense	probably benign	0.05
R7372:Trrap	UTSW	5	144789398	missense	probably benign
R7447:Trrap	UTSW	5	144839474	missense	probably damaging	0.97
R7449:Trrap	UTSW	5	144851209	missense	probably damaging	1.00
R7655:Trrap	UTSW	5	144842612	missense	probably damaging	1.00
R7656:Trrap	UTSW	5	144842612	missense	probably damaging	1.00
R7662:Trrap	UTSW	5	144832511	missense	probably benign	0.00
R7716:Trrap	UTSW	5	144777146	missense	possibly damaging	0.73
R8143:Trrap	UTSW	5	144835897	splice site	probably null
R8183:Trrap	UTSW	5	144828533	missense	probably benign	0.01
R8265:Trrap	UTSW	5	144785534	missense	possibly damaging	0.53
R8273:Trrap	UTSW	5	144791165	missense	probably damaging	1.00
R8556:Trrap	UTSW	5	144825937	missense	probably benign	0.44
R8674:Trrap	UTSW	5	144791032	missense	probably benign	0.02
R8777:Trrap	UTSW	5	144837139	missense	probably benign	0.10
R8777-TAIL:Trrap	UTSW	5	144837139	missense	probably benign	0.10
R8817:Trrap	UTSW	5	144845538	missense	probably damaging	1.00
R8841:Trrap	UTSW	5	144844211	missense	probably damaging	1.00
R8871:Trrap	UTSW	5	144821839	missense	probably benign	0.30
R8937:Trrap	UTSW	5	144820253	missense	probably damaging	1.00
R8966:Trrap	UTSW	5	144803352	missense	probably damaging	0.96
R9010:Trrap	UTSW	5	144846416	missense	probably damaging	1.00
R9095:Trrap	UTSW	5	144797151	missense	probably damaging	1.00
R9127:Trrap	UTSW	5	144831020	missense	probably benign	0.16
R9132:Trrap	UTSW	5	144789552	missense	probably benign	0.03
R9224:Trrap	UTSW	5	144771239	missense	possibly damaging	0.70
R9338:Trrap	UTSW	5	144791115	missense	probably benign
R9380:Trrap	UTSW	5	144833171	missense	probably benign
R9404:Trrap	UTSW	5	144815415	missense	possibly damaging	0.85
R9464:Trrap	UTSW	5	144826707	missense	probably damaging	0.99
R9504:Trrap	UTSW	5	144806094	missense	probably damaging	1.00
R9583:Trrap	UTSW	5	144840520	missense	probably damaging	1.00
R9584:Trrap	UTSW	5	144840520	missense	probably damaging	1.00
R9585:Trrap	UTSW	5	144840520	missense	probably damaging	1.00
R9608:Trrap	UTSW	5	144843318	missense	possibly damaging	0.60
R9728:Trrap	UTSW	5	144789383	missense	probably benign	0.22
R9782:Trrap	UTSW	5	144821906	missense	probably damaging	0.99
X0060:Trrap	UTSW	5	144843361	missense	probably damaging	0.96
Z1088:Trrap	UTSW	5	144834197	missense	probably benign	0.00
Z1177:Trrap	UTSW	5	144810344	missense
Z1177:Trrap	UTSW	5	144819708	missense	probably damaging	1.00
Z1177:Trrap	UTSW	5	144856951	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACTGATTTGGGTGGTCATCTG -3'
(R):5'- TCTACGCCTCCTCGAGTGG -3'

Sequencing Primer
(F):5'- GGTGGTCATCTGGCTCTTCTC -3'
(R):5'- AATGGGCTTCCAGGTTTCCAAAG -3'

Posted On

2022-06-15