Incidental Mutation 'R9459:Gadl1'
ID 714767
Institutional Source Beutler Lab
Gene Symbol Gadl1
Ensembl Gene ENSMUSG00000056880
Gene Name glutamate decarboxylase-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 115909455-116076176 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115965611 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 285 (W285R)
Ref Sequence ENSEMBL: ENSMUSP00000112433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069651] [ENSMUST00000119291] [ENSMUST00000121770]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069651
AA Change: W285R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077694
Gene: ENSMUSG00000056880
AA Change: W285R

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 1.1e-113 PFAM
Pfam:Beta_elim_lyase 137 467 1e-7 PFAM
Pfam:Aminotran_5 167 333 1.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119291
AA Change: W285R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112433
Gene: ENSMUSG00000056880
AA Change: W285R

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 3.2e-112 PFAM
Pfam:Beta_elim_lyase 137 446 1.6e-6 PFAM
Pfam:Aminotran_5 184 330 3.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121770
AA Change: W285R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113240
Gene: ENSMUSG00000056880
AA Change: W285R

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 2.8e-112 PFAM
Pfam:Beta_elim_lyase 137 461 6.2e-8 PFAM
Pfam:Aminotran_5 184 330 4.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Gadl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Gadl1 APN 9 115954839 critical splice donor site probably null
IGL01343:Gadl1 APN 9 116074112 makesense probably null
IGL01693:Gadl1 APN 9 115949585 missense probably damaging 1.00
IGL02106:Gadl1 APN 9 115937157 utr 5 prime probably benign
IGL02740:Gadl1 APN 9 116006561 nonsense probably null
IGL03063:Gadl1 APN 9 115966267 missense probably damaging 1.00
IGL03104:Gadl1 APN 9 116074040 missense possibly damaging 0.93
IGL03127:Gadl1 APN 9 115948664 missense probably damaging 1.00
R0133:Gadl1 UTSW 9 115941343 missense probably benign 0.00
R0285:Gadl1 UTSW 9 116030738 splice site probably benign
R0737:Gadl1 UTSW 9 116073987 missense probably damaging 0.99
R0771:Gadl1 UTSW 9 115944232 missense probably damaging 1.00
R1522:Gadl1 UTSW 9 115944229 missense probably damaging 1.00
R1716:Gadl1 UTSW 9 116006508 nonsense probably null
R2061:Gadl1 UTSW 9 115941380 missense probably damaging 1.00
R2163:Gadl1 UTSW 9 115949558 missense possibly damaging 0.93
R3854:Gadl1 UTSW 9 116006664 nonsense probably null
R3964:Gadl1 UTSW 9 115965608 missense probably damaging 0.98
R4654:Gadl1 UTSW 9 115941340 missense probably damaging 1.00
R4724:Gadl1 UTSW 9 115954617 missense possibly damaging 0.81
R4765:Gadl1 UTSW 9 115966313 missense probably null 0.00
R4956:Gadl1 UTSW 9 116040919 missense probably benign 0.00
R5179:Gadl1 UTSW 9 115960380 nonsense probably null
R5593:Gadl1 UTSW 9 116006650 missense probably damaging 1.00
R5620:Gadl1 UTSW 9 115937162 start codon destroyed probably benign 0.09
R6048:Gadl1 UTSW 9 116006701 splice site probably null
R6458:Gadl1 UTSW 9 116041002 makesense probably null
R7497:Gadl1 UTSW 9 116074087 missense probably benign 0.00
R7889:Gadl1 UTSW 9 115954815 missense possibly damaging 0.56
R8843:Gadl1 UTSW 9 116006501 missense probably benign 0.00
R8858:Gadl1 UTSW 9 116006601 missense probably damaging 1.00
R9015:Gadl1 UTSW 9 115965637 missense probably benign 0.03
R9758:Gadl1 UTSW 9 115960451 missense probably benign 0.09
Z1088:Gadl1 UTSW 9 115937270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATGAGGACTCTACTGGGGTTCG -3'
(R):5'- CATGGGATTCCTCATCTAAGGG -3'

Sequencing Primer
(F):5'- GGTTCGTATTGCCTGATCAGACTC -3'
(R):5'- AGGACCTAATTGACTGAGTTACTCCC -3'
Posted On 2022-06-15