Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Scaf8'

728935

Institutional Source

Beutler Lab

Gene Symbol

Scaf8

Ensembl Gene

ENSMUSG00000046201

Gene Name

SR-related CTD-associated factor 8

Synonyms

Rbm16, A630086M08Rik, A930036P18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.785) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3114972-3198859 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3171135 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 299 (I299N)

Ref Sequence

ENSEMBL: ENSMUSP00000076024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076734]

AlphaFold

Q6DID3

Predicted Effect

unknown
Transcript: ENSMUST00000076734
AA Change: I299N

SMART Domains

Protein: ENSMUSP00000076024
Gene: ENSMUSG00000046201
AA Change: I299N

Domain	Start	End	E-Value	Type
RPR	6	136	1.26e-42	SMART
low complexity region	157	171	N/A	INTRINSIC
low complexity region	193	223	N/A	INTRINSIC
low complexity region	232	251	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	305	326	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	397	462	N/A	INTRINSIC
RRM	478	547	9.2e-14	SMART
low complexity region	644	677	N/A	INTRINSIC
low complexity region	685	712	N/A	INTRINSIC
low complexity region	857	883	N/A	INTRINSIC
low complexity region	941	953	N/A	INTRINSIC
low complexity region	962	971	N/A	INTRINSIC
low complexity region	1027	1044	N/A	INTRINSIC
internal_repeat_1	1048	1064	2e-5	PROSPERO
internal_repeat_1	1059	1075	2e-5	PROSPERO
low complexity region	1146	1168	N/A	INTRINSIC
low complexity region	1249	1268	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Scaf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00496:Scaf8	APN	17	3171134	missense	unknown
IGL00956:Scaf8	APN	17	3171147	missense	unknown
IGL01610:Scaf8	APN	17	3195849	missense	probably damaging	1.00
IGL01967:Scaf8	APN	17	3196938	missense	possibly damaging	0.91
IGL02005:Scaf8	APN	17	3185870	missense	probably damaging	1.00
IGL03037:Scaf8	APN	17	3190221	missense	probably damaging	0.99
BB004:Scaf8	UTSW	17	3159220	missense	unknown
BB014:Scaf8	UTSW	17	3159220	missense	unknown
R0320:Scaf8	UTSW	17	3178255	missense	unknown
R0789:Scaf8	UTSW	17	3196837	missense	possibly damaging	0.94
R0850:Scaf8	UTSW	17	3195774	splice site	probably null
R0919:Scaf8	UTSW	17	3197120	missense	probably damaging	1.00
R1488:Scaf8	UTSW	17	3197597	missense	probably damaging	0.97
R1544:Scaf8	UTSW	17	3145154	missense	probably damaging	0.96
R1928:Scaf8	UTSW	17	3168077	missense	unknown
R1972:Scaf8	UTSW	17	3169371	missense	unknown
R2156:Scaf8	UTSW	17	3164132	splice site	probably null
R2164:Scaf8	UTSW	17	3197210	missense	probably damaging	1.00
R2680:Scaf8	UTSW	17	3197591	missense	possibly damaging	0.95
R3794:Scaf8	UTSW	17	3190249	missense	probably damaging	1.00
R4368:Scaf8	UTSW	17	3171195	missense	unknown
R4673:Scaf8	UTSW	17	3197985	missense	probably benign	0.04
R4694:Scaf8	UTSW	17	3197404	missense	probably damaging	1.00
R4716:Scaf8	UTSW	17	3177123	missense	unknown
R4852:Scaf8	UTSW	17	3178219	missense	unknown
R5036:Scaf8	UTSW	17	3164262	unclassified	probably benign
R5193:Scaf8	UTSW	17	3190165	missense	probably benign	0.02
R5429:Scaf8	UTSW	17	3197110	missense	probably benign	0.14
R5816:Scaf8	UTSW	17	3177713	missense	unknown
R6050:Scaf8	UTSW	17	3168108	missense	unknown
R6493:Scaf8	UTSW	17	3171119	missense	unknown
R6616:Scaf8	UTSW	17	3168055	missense	unknown
R7065:Scaf8	UTSW	17	3159211	missense	probably damaging	1.00
R7112:Scaf8	UTSW	17	3163029	missense	unknown
R7141:Scaf8	UTSW	17	3159182	missense	unknown
R7198:Scaf8	UTSW	17	3163098	missense	unknown
R7265:Scaf8	UTSW	17	3177625	missense	unknown
R7592:Scaf8	UTSW	17	3171222	critical splice donor site	probably null
R7711:Scaf8	UTSW	17	3187634	missense	probably damaging	0.97
R7813:Scaf8	UTSW	17	3197274	missense	probably damaging	1.00
R7867:Scaf8	UTSW	17	3177719	missense	unknown
R7927:Scaf8	UTSW	17	3159220	missense	unknown
R7937:Scaf8	UTSW	17	3197207	missense	probably damaging	0.99
R7958:Scaf8	UTSW	17	3171122	missense	unknown
R7960:Scaf8	UTSW	17	3171122	missense	unknown
R8024:Scaf8	UTSW	17	3159293	missense	unknown
R8118:Scaf8	UTSW	17	3164183	missense	unknown
R8285:Scaf8	UTSW	17	3177129	missense	unknown
R8303:Scaf8	UTSW	17	3148552	missense	unknown
R8365:Scaf8	UTSW	17	3195966	missense	possibly damaging	0.67
R8544:Scaf8	UTSW	17	3163020	unclassified	probably benign
R8768:Scaf8	UTSW	17	3193074	missense	probably benign	0.27
R9520:Scaf8	UTSW	17	3198010	missense	probably damaging	1.00
R9521:Scaf8	UTSW	17	3198010	missense	probably damaging	1.00
R9603:Scaf8	UTSW	17	3195795	missense	possibly damaging	0.80
R9622:Scaf8	UTSW	17	3197895	missense	probably benign	0.21
Z1088:Scaf8	UTSW	17	3162983	unclassified	probably benign
Z1177:Scaf8	UTSW	17	3162994	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CACTGCAGTAGAGTTCCTTGTGTG -3'
(R):5'- GGCACAGCTATAAAGGTCTTTG -3'

Sequencing Primer
(F):5'- CAGTAGAGTTCCTTGTGTGAAGTGC -3'
(R):5'- CACAGCTATAAAGGTCTTTGAAAGG -3'

Posted On

2022-10-06