Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Tshr'

728928

Institutional Source

Beutler Lab

Gene Symbol

Tshr

Ensembl Gene

ENSMUSG00000020963

Gene Name

thyroid stimulating hormone receptor

Synonyms

pet, hyt, hypothroid

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.242) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

91384563-91549808 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 91537665 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 459 (A459E)

Ref Sequence

ENSEMBL: ENSMUSP00000021346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021346] [ENSMUST00000186437] [ENSMUST00000221216]

AlphaFold

P47750

Predicted Effect

probably damaging
Transcript: ENSMUST00000021346
AA Change: A459E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: A459E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:LRR_5	53	153	9.5e-7	PFAM
Pfam:LRR_5	148	244	5.1e-5	PFAM
Pfam:7tm_1	431	678	2.6e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000186437

SMART Domains

Protein: ENSMUSP00000139632
Gene: ENSMUSG00000020963

Domain	Start	End	E-Value	Type
Pfam:7tm_1	1	86	6.4e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221216

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Tshr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00647:Tshr	APN	12	91537500	missense	probably damaging	1.00
IGL01503:Tshr	APN	12	91511934	missense	probably damaging	1.00
IGL01730:Tshr	APN	12	91519303	missense	possibly damaging	0.93
IGL02109:Tshr	APN	12	91537992	missense	probably damaging	1.00
IGL02199:Tshr	APN	12	91538283	missense	probably damaging	1.00
IGL02439:Tshr	APN	12	91537547	missense	probably damaging	0.97
IGL02696:Tshr	APN	12	91493329	missense	possibly damaging	0.72
IGL03170:Tshr	APN	12	91537869	missense	probably damaging	1.00
IGL03208:Tshr	APN	12	91533942	missense	probably damaging	1.00
freckle	UTSW	12	91538226	nonsense	probably null
R0067_Tshr_655	UTSW	12	91505283	missense	probably damaging	1.00
R0017:Tshr	UTSW	12	91537886	missense	possibly damaging	0.95
R0017:Tshr	UTSW	12	91537886	missense	possibly damaging	0.95
R0067:Tshr	UTSW	12	91505283	missense	probably damaging	1.00
R0419:Tshr	UTSW	12	91537869	missense	probably damaging	1.00
R0658:Tshr	UTSW	12	91538226	nonsense	probably null
R0724:Tshr	UTSW	12	91538286	missense	probably damaging	1.00
R1170:Tshr	UTSW	12	91538097	missense	probably damaging	1.00
R1188:Tshr	UTSW	12	91502168	missense	probably benign	0.00
R1548:Tshr	UTSW	12	91534031	missense	probably damaging	1.00
R1677:Tshr	UTSW	12	91537341	missense	possibly damaging	0.81
R1808:Tshr	UTSW	12	91537316	missense	probably benign	0.00
R1934:Tshr	UTSW	12	91537181	missense	probably damaging	0.99
R3980:Tshr	UTSW	12	91537743	missense	probably damaging	1.00
R4008:Tshr	UTSW	12	91537494	missense	probably benign	0.21
R4828:Tshr	UTSW	12	91537790	missense	probably damaging	1.00
R4903:Tshr	UTSW	12	91401188	missense	probably benign	0.09
R4958:Tshr	UTSW	12	91538187	missense	probably damaging	1.00
R5528:Tshr	UTSW	12	91537193	missense	probably damaging	1.00
R5949:Tshr	UTSW	12	91537218	missense	probably damaging	1.00
R6136:Tshr	UTSW	12	91538234	missense	probably benign	0.34
R6147:Tshr	UTSW	12	91538235	missense	possibly damaging	0.84
R6454:Tshr	UTSW	12	91538549	missense	probably benign	0.33
R6572:Tshr	UTSW	12	91538360	missense	probably benign	0.29
R6884:Tshr	UTSW	12	91538102	missense	probably damaging	1.00
R6986:Tshr	UTSW	12	91533957	missense	probably damaging	0.97
R7403:Tshr	UTSW	12	91497774	missense	probably damaging	1.00
R7691:Tshr	UTSW	12	91497741	missense	probably benign	0.00
R7741:Tshr	UTSW	12	91533969	nonsense	probably null
R7769:Tshr	UTSW	12	91538270	missense	probably damaging	1.00
R7784:Tshr	UTSW	12	91505305	missense	probably benign	0.02
R7934:Tshr	UTSW	12	91511928	missense	possibly damaging	0.88
R8060:Tshr	UTSW	12	91538360	missense	probably benign	0.12
R8168:Tshr	UTSW	12	91511965	missense	probably benign	0.19
R8552:Tshr	UTSW	12	91537285	missense	probably benign	0.00
R8762:Tshr	UTSW	12	91537550	missense	probably damaging	1.00
R8917:Tshr	UTSW	12	91502055	intron	probably benign
R8918:Tshr	UTSW	12	91537437	missense	probably benign	0.00
R8945:Tshr	UTSW	12	91538223	missense	probably damaging	1.00
R9002:Tshr	UTSW	12	91537774	missense	possibly damaging	0.95
R9056:Tshr	UTSW	12	91507789	missense	probably damaging	1.00
R9122:Tshr	UTSW	12	91511963	missense	probably benign	0.19
R9126:Tshr	UTSW	12	91537218	missense	probably damaging	1.00
R9282:Tshr	UTSW	12	91507744	missense	possibly damaging	0.53
R9488:Tshr	UTSW	12	91537815	missense	probably damaging	1.00
R9630:Tshr	UTSW	12	91537635	missense	probably damaging	1.00
R9632:Tshr	UTSW	12	91537635	missense	probably damaging	1.00
Z1176:Tshr	UTSW	12	91538491	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GACGAGTTTAACCCCTGTGAAG -3'
(R):5'- TGAGGCGGATCTTCCTATCC -3'

Sequencing Primer
(F):5'- CCCTGTGAAGATATCATGGGCTAC -3'
(R):5'- TTCCTATCCAGGCGCATGG -3'

Posted On

2022-10-06