Incidental Mutation 'R0884:Fer1l4'
ID 81015
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission 039051-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0884 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 155861233 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1978 (T1978A)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006035] [ENSMUST00000088650] [ENSMUST00000109611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006035
SMART Domains Protein: ENSMUSP00000006035
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:ERGIC_N 6 101 2.2e-38 PFAM
Pfam:COPIIcoated_ERV 145 363 6.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088650
SMART Domains Protein: ENSMUSP00000086025
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:ERGIC_N 7 97 9e-35 PFAM
Pfam:COPIIcoated_ERV 145 374 7e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109611
AA Change: T1978A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: T1978A

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149381
Predicted Effect probably benign
Transcript: ENSMUST00000142859
SMART Domains Protein: ENSMUSP00000115912
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 74 246 1.9e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155370
SMART Domains Protein: ENSMUSP00000119051
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 21 235 1e-95 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,790,700 (GRCm39) I844N possibly damaging Het
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adam6b A T 12: 113,454,615 (GRCm39) R477S probably damaging Het
Aqp7 T A 4: 41,034,929 (GRCm39) T175S possibly damaging Het
Bclaf1 A T 10: 20,197,822 (GRCm39) R22* probably null Het
Bend7 A T 2: 4,749,055 (GRCm39) K57N probably damaging Het
Bicc1 A C 10: 70,794,677 (GRCm39) V160G probably damaging Het
Cacna2d4 C T 6: 119,284,247 (GRCm39) R745W probably damaging Het
Cep72 A G 13: 74,203,000 (GRCm39) probably null Het
Cobl A G 11: 12,325,908 (GRCm39) I196T possibly damaging Het
Cux1 T G 5: 136,336,689 (GRCm39) D941A probably damaging Het
Cyp2a12 T C 7: 26,731,967 (GRCm39) I236T probably benign Het
Dennd2b A G 7: 109,156,552 (GRCm39) L66P probably damaging Het
Depdc5 T A 5: 33,075,322 (GRCm39) V500D possibly damaging Het
Dhx35 T C 2: 158,673,631 (GRCm39) I354T probably damaging Het
Dnase1l2 A G 17: 24,660,854 (GRCm39) V170A possibly damaging Het
Eif4g3 C A 4: 137,879,087 (GRCm39) N588K possibly damaging Het
Epsti1 A T 14: 78,168,715 (GRCm39) R117S probably damaging Het
Fam53a T C 5: 33,758,160 (GRCm39) E321G probably benign Het
Fat4 C A 3: 39,037,007 (GRCm39) T3553K possibly damaging Het
Gabarapl2 A T 8: 112,669,137 (GRCm39) I32F probably damaging Het
Gje1 G T 10: 14,592,484 (GRCm39) S99R possibly damaging Het
Gosr1 A G 11: 76,620,972 (GRCm39) I239T probably benign Het
Gpnmb T C 6: 49,024,847 (GRCm39) V293A possibly damaging Het
Hyi T A 4: 118,217,414 (GRCm39) I62N probably damaging Het
Il4ra A G 7: 125,173,835 (GRCm39) I267V probably damaging Het
Kcnd2 A T 6: 21,216,540 (GRCm39) Q81H probably benign Het
Ksr1 A T 11: 78,912,329 (GRCm39) H675Q possibly damaging Het
Lpcat4 A G 2: 112,073,077 (GRCm39) N208S probably damaging Het
Muc17 T A 5: 137,171,146 (GRCm39) T162S possibly damaging Het
Mup3 T A 4: 62,005,411 (GRCm39) I20F possibly damaging Het
Nebl A C 2: 17,415,929 (GRCm39) S327A probably benign Het
Nfatc4 A C 14: 56,064,101 (GRCm39) D126A probably damaging Het
Nmt2 A T 2: 3,315,822 (GRCm39) R271* probably null Het
Nol7 G A 13: 43,554,091 (GRCm39) V133I probably benign Het
Or1e1c A T 11: 73,265,715 (GRCm39) I47F probably benign Het
Or51ag1 C T 7: 103,156,069 (GRCm39) W28* probably null Het
Pde4d A T 13: 110,087,474 (GRCm39) I670L probably damaging Het
Phlpp1 T A 1: 106,317,395 (GRCm39) probably null Het
Pigz A G 16: 31,760,794 (GRCm39) probably null Het
Pramel21 A G 4: 143,341,754 (GRCm39) D61G probably benign Het
Prrg4 A T 2: 104,669,707 (GRCm39) Y137N probably damaging Het
Rbm28 A T 6: 29,155,153 (GRCm39) S217T possibly damaging Het
Ryr2 T C 13: 11,569,415 (GRCm39) D4963G probably damaging Het
Slc35b2 T A 17: 45,877,751 (GRCm39) F293I probably damaging Het
Slc35f1 A T 10: 52,965,443 (GRCm39) Y286F probably damaging Het
Slc6a18 G T 13: 73,815,156 (GRCm39) A384D probably damaging Het
Syt9 A G 7: 107,035,768 (GRCm39) I262V probably damaging Het
Tln2 C A 9: 67,278,015 (GRCm39) R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,786,756 (GRCm39) probably benign Het
Ttn G A 2: 76,581,410 (GRCm39) T14834I possibly damaging Het
Uggt1 T C 1: 36,214,159 (GRCm39) S177G probably benign Het
Zfp454 A G 11: 50,764,764 (GRCm39) S223P probably benign Het
Zmat4 A G 8: 24,505,143 (GRCm39) T128A probably benign Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTGAACCCAAGGACTGAGCCCTTC -3'
(R):5'- CACAGTGCGTAGCCCATAATGACC -3'

Sequencing Primer
(F):5'- TTCCAGGGCACATTGCAAG -3'
(R):5'- CCATAATGACCAGGGGCTG -3'
Posted On 2013-11-07