Mutagenetix > Incidental Mutations

Incidental Mutation 'R2075:Ptprn2'

227556

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

040080-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.291) question?

Stock #

R2075 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 117247717 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 839 (V839I)

Ref Sequence

ENSEMBL: ENSMUSP00000139978 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

Predicted Effect

probably benign
Transcript: ENSMUST00000070733
AA Change: V839I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: V839I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083604

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190132

Predicted Effect

probably benign
Transcript: ENSMUST00000190247
AA Change: V839I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: V839I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	C	T	6: 129,326,703	E100K	probably benign	Het
4930430A15Rik	T	C	2: 111,200,418	E382G	probably damaging	Het
Abca13	T	C	11: 9,522,382	F4263L	probably damaging	Het
Aebp2	G	A	6: 140,633,694	S219N	probably benign	Het
Anln	C	A	9: 22,333,168	W1083L	probably benign	Het
Atic	T	A	1: 71,576,127	D438E	probably benign	Het
Bahcc1	G	A	11: 120,271,689	C271Y	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Ccdc149	A	G	5: 52,439,168	L34P	probably damaging	Het
Cd22	C	G	7: 30,869,698	C637S	probably damaging	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chmp1a	A	T	8: 123,208,022	M65K	probably damaging	Het
Clec16a	G	A	16: 10,741,616	A918T	probably benign	Het
Cnot1	G	T	8: 95,739,833	T1592K	possibly damaging	Het
Ddx10	A	T	9: 53,240,505	D73E	probably benign	Het
Dhx32	T	C	7: 133,721,292	N731S	probably benign	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dna2	A	G	10: 62,969,822	Q946R	probably benign	Het
Duox2	T	A	2: 122,295,158	S323C	probably damaging	Het
Esr2	A	G	12: 76,165,447		probably null	Het
Fbxo9	G	T	9: 78,084,516	H397N	possibly damaging	Het
Fsip2	T	A	2: 82,988,579	N4885K	possibly damaging	Het
Gm12695	T	C	4: 96,723,945	Y527C	possibly damaging	Het
Hivep1	A	G	13: 42,156,318	D678G	probably damaging	Het
Hmcn1	T	A	1: 150,577,323	I5414F	possibly damaging	Het
Hspb2	T	C	9: 50,751,346	Y67C	probably benign	Het
Kbtbd8	T	A	6: 95,126,683	C438S	possibly damaging	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
Ky	A	G	9: 102,542,746	S651G	probably damaging	Het
Lgals12	T	C	19: 7,598,845	D238G	possibly damaging	Het
Lpcat3	T	A	6: 124,703,103	Y380N	probably damaging	Het
Mdn1	A	G	4: 32,716,058	H2080R	probably benign	Het
Mex3c	C	T	18: 73,589,769	S311L	probably benign	Het
Mlh3	A	T	12: 85,269,141	Y90*	probably null	Het
Mpped2	T	A	2: 106,744,802	Y77*	probably null	Het
Myo5a	A	T	9: 75,189,918	T49S	probably benign	Het
Nsd1	T	C	13: 55,310,500	V2142A	possibly damaging	Het
Olfr1247	A	G	2: 89,609,478	V208A	probably benign	Het
Olfr201	T	C	16: 59,268,911	Y252C	possibly damaging	Het
Olfr64	T	A	7: 103,892,920	I272F	probably damaging	Het
Olfr641	T	A	7: 104,039,973	M59K	probably damaging	Het
Pdgfra	T	C	5: 75,187,948	I883T	probably damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phf24	A	G	4: 42,939,507	Y333C	possibly damaging	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Piezo2	C	T	18: 63,081,734	E1263K	probably damaging	Het
Pitrm1	A	G	13: 6,555,383	T149A	probably damaging	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plch2	A	T	4: 154,989,909	L754Q	probably damaging	Het
Polr2c	A	G	8: 94,863,567	I267V	probably benign	Het
Prss8	C	A	7: 127,927,094	R148L	possibly damaging	Het
Ptpn2	T	A	18: 67,681,475	T155S	probably damaging	Het
Sbp	A	G	17: 23,945,158		probably null	Het
Sec16a	A	G	2: 26,440,239	I588T	probably damaging	Het
Six2	A	G	17: 85,687,505	S150P	probably damaging	Het
Slc5a5	C	T	8: 70,892,439	G75R	possibly damaging	Het
Slc6a20b	T	A	9: 123,595,034	T623S	probably benign	Het
Sqle	T	A	15: 59,323,901	V342E	probably damaging	Het
Stk3	T	C	15: 34,959,049	M256V	possibly damaging	Het
Tek	A	G	4: 94,827,729	I463V	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tnc	G	A	4: 63,995,666	T1303M	possibly damaging	Het
Traf6	A	C	2: 101,697,053	I383L	probably benign	Het
Tubb3	C	T	8: 123,421,270	A314V	probably damaging	Het
Vmn1r199	A	T	13: 22,383,265	Y243F	probably damaging	Het
Vmn2r111	A	C	17: 22,559,062	N545K	probably damaging	Het
Vmn2r27	T	A	6: 124,200,551	Q498L	possibly damaging	Het
Vstm4	A	T	14: 32,917,854	S229C	probably damaging	Het
Wdr12	C	T	1: 60,091,063	R63Q	possibly damaging	Het
Wdr78	G	A	4: 103,050,193	T632M	probably damaging	Het
Wrn	T	A	8: 33,322,329	I187L	probably benign	Het
Xirp2	A	T	2: 67,510,201	I929L	probably benign	Het
Ywhae	T	A	11: 75,764,660	D252E	probably benign	Het
Zfp944	A	T	17: 22,339,197	C356*	probably null	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TCTCATGGAACCTATAGACCATTGAG -3'
(R):5'- TCCCTCTGATGTCAACGTGC -3'

Sequencing Primer
(F):5'- CCATTGAGATAATGTATTCAGAGGGC -3'
(R):5'- TCAACGTGCTGACAGCC -3'

Posted On

2014-09-17