Incidental Mutation 'R2075:Ptprn2'
ID 227556
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 040080-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R2075 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 117211337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 839 (V839I)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: V839I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: V839I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190132
Predicted Effect probably benign
Transcript: ENSMUST00000190247
AA Change: V839I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: V839I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,472,382 (GRCm39) F4263L probably damaging Het
Aebp2 G A 6: 140,579,420 (GRCm39) S219N probably benign Het
Anln C A 9: 22,244,464 (GRCm39) W1083L probably benign Het
Atic T A 1: 71,615,286 (GRCm39) D438E probably benign Het
Bahcc1 G A 11: 120,162,515 (GRCm39) C271Y probably damaging Het
Btbd17 A T 11: 114,682,778 (GRCm39) probably null Het
Ccdc122 T C 14: 77,306,391 (GRCm39) probably null Het
Ccdc149 A G 5: 52,596,510 (GRCm39) L34P probably damaging Het
Cd22 C G 7: 30,569,123 (GRCm39) C637S probably damaging Het
Ces1a T A 8: 93,774,703 (GRCm39) N12Y probably benign Het
Chmp1a A T 8: 123,934,761 (GRCm39) M65K probably damaging Het
Clec16a G A 16: 10,559,480 (GRCm39) A918T probably benign Het
Clec2m C T 6: 129,303,666 (GRCm39) E100K probably benign Het
Cnot1 G T 8: 96,466,461 (GRCm39) T1592K possibly damaging Het
Ddx10 A T 9: 53,151,805 (GRCm39) D73E probably benign Het
Dhx32 T C 7: 133,323,021 (GRCm39) N731S probably benign Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Dna2 A G 10: 62,805,601 (GRCm39) Q946R probably benign Het
Dnai4 G A 4: 102,907,390 (GRCm39) T632M probably damaging Het
Duox2 T A 2: 122,125,639 (GRCm39) S323C probably damaging Het
Esr2 A G 12: 76,212,221 (GRCm39) probably null Het
Fbxo9 G T 9: 77,991,798 (GRCm39) H397N possibly damaging Het
Fsip2 T A 2: 82,818,923 (GRCm39) N4885K possibly damaging Het
Gm12695 T C 4: 96,612,182 (GRCm39) Y527C possibly damaging Het
Hivep1 A G 13: 42,309,794 (GRCm39) D678G probably damaging Het
Hmcn1 T A 1: 150,453,074 (GRCm39) I5414F possibly damaging Het
Hspb2 T C 9: 50,662,646 (GRCm39) Y67C probably benign Het
Kbtbd8 T A 6: 95,103,664 (GRCm39) C438S possibly damaging Het
Kif5a T C 10: 127,081,238 (GRCm39) D232G probably damaging Het
Ky A G 9: 102,419,945 (GRCm39) S651G probably damaging Het
Lgals12 T C 19: 7,576,210 (GRCm39) D238G possibly damaging Het
Lpcat3 T A 6: 124,680,066 (GRCm39) Y380N probably damaging Het
Mdn1 A G 4: 32,716,058 (GRCm39) H2080R probably benign Het
Mex3c C T 18: 73,722,840 (GRCm39) S311L probably benign Het
Mlh3 A T 12: 85,315,915 (GRCm39) Y90* probably null Het
Mpped2 T A 2: 106,575,147 (GRCm39) Y77* probably null Het
Myo5a A T 9: 75,097,200 (GRCm39) T49S probably benign Het
Nsd1 T C 13: 55,458,313 (GRCm39) V2142A possibly damaging Het
Or4a74 A G 2: 89,439,822 (GRCm39) V208A probably benign Het
Or51b17 T A 7: 103,542,127 (GRCm39) I272F probably damaging Het
Or51i2 T A 7: 103,689,180 (GRCm39) M59K probably damaging Het
Or5ac19 T C 16: 59,089,274 (GRCm39) Y252C possibly damaging Het
Pdgfra T C 5: 75,348,609 (GRCm39) I883T probably damaging Het
Pdzd2 A G 15: 12,385,905 (GRCm39) L955P probably damaging Het
Phf24 A G 4: 42,939,507 (GRCm39) Y333C possibly damaging Het
Phlpp2 T C 8: 110,655,124 (GRCm39) S605P possibly damaging Het
Piezo2 C T 18: 63,214,805 (GRCm39) E1263K probably damaging Het
Pitrm1 A G 13: 6,605,419 (GRCm39) T149A probably damaging Het
Pkhd1l1 G T 15: 44,422,035 (GRCm39) A3102S probably damaging Het
Plch2 A T 4: 155,074,366 (GRCm39) L754Q probably damaging Het
Polr2c A G 8: 95,590,195 (GRCm39) I267V probably benign Het
Potefam1 T C 2: 111,030,763 (GRCm39) E382G probably damaging Het
Prss8 C A 7: 127,526,266 (GRCm39) R148L possibly damaging Het
Ptpn2 T A 18: 67,814,545 (GRCm39) T155S probably damaging Het
Sbp A G 17: 24,164,132 (GRCm39) probably null Het
Sec16a A G 2: 26,330,251 (GRCm39) I588T probably damaging Het
Six2 A G 17: 85,994,933 (GRCm39) S150P probably damaging Het
Slc5a5 C T 8: 71,345,083 (GRCm39) G75R possibly damaging Het
Slc6a20b T A 9: 123,424,099 (GRCm39) T623S probably benign Het
Sqle T A 15: 59,195,750 (GRCm39) V342E probably damaging Het
Stk3 T C 15: 34,959,195 (GRCm39) M256V possibly damaging Het
Tek A G 4: 94,715,966 (GRCm39) I463V probably benign Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tnc G A 4: 63,913,903 (GRCm39) T1303M possibly damaging Het
Traf6 A C 2: 101,527,398 (GRCm39) I383L probably benign Het
Tubb3 C T 8: 124,148,009 (GRCm39) A314V probably damaging Het
Vmn1r199 A T 13: 22,567,435 (GRCm39) Y243F probably damaging Het
Vmn2r111 A C 17: 22,778,043 (GRCm39) N545K probably damaging Het
Vmn2r27 T A 6: 124,177,510 (GRCm39) Q498L possibly damaging Het
Vstm4 A T 14: 32,639,811 (GRCm39) S229C probably damaging Het
Wdr12 C T 1: 60,130,222 (GRCm39) R63Q possibly damaging Het
Wrn T A 8: 33,812,357 (GRCm39) I187L probably benign Het
Xirp2 A T 2: 67,340,545 (GRCm39) I929L probably benign Het
Ywhae T A 11: 75,655,486 (GRCm39) D252E probably benign Het
Zfp944 A T 17: 22,558,178 (GRCm39) C356* probably null Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCATGGAACCTATAGACCATTGAG -3'
(R):5'- TCCCTCTGATGTCAACGTGC -3'

Sequencing Primer
(F):5'- CCATTGAGATAATGTATTCAGAGGGC -3'
(R):5'- TCAACGTGCTGACAGCC -3'
Posted On 2014-09-17