Mutagenetix > Incidental Mutation

Incidental Mutation 'R2354:Pitpnm2'

246821

Institutional Source

Beutler Lab

Gene Symbol

Pitpnm2

Ensembl Gene

ENSMUSG00000029406

Gene Name

phosphatidylinositol transfer protein, membrane-associated 2

Synonyms

NIR3, RDGBA2, Rdgb2

MMRRC Submission

040336-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2354 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124118690-124249760 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 124122919 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1010 (V1010E)

Ref Sequence

ENSEMBL: ENSMUSP00000124740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031351] [ENSMUST00000086123] [ENSMUST00000122394] [ENSMUST00000145667] [ENSMUST00000161273] [ENSMUST00000161938] [ENSMUST00000162812] [ENSMUST00000196401]

AlphaFold

Q6ZPQ6

Predicted Effect

probably benign
Transcript: ENSMUST00000031351

SMART Domains

Protein: ENSMUSP00000031351
Gene: ENSMUSG00000029404

Domain	Start	End	E-Value	Type
Pfam:SR-25	7	227	2.7e-104	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000086123
AA Change: V1010E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: V1010E

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	6.1e-132	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	507	515	N/A	INTRINSIC
Blast:DDHD	548	570	6e-7	BLAST
low complexity region	571	589	N/A	INTRINSIC
low complexity region	608	630	N/A	INTRINSIC
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	895	1.66e-98	SMART
LNS2	1040	1171	3.22e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122394

SMART Domains

Protein: ENSMUSP00000112506
Gene: ENSMUSG00000029404

Domain	Start	End	E-Value	Type
Pfam:SR-25	2	199	6.3e-85	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145667

SMART Domains

Protein: ENSMUSP00000122377
Gene: ENSMUSG00000029404

Domain	Start	End	E-Value	Type
Pfam:SR-25	19	227	3e-86	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159628

Predicted Effect

probably benign
Transcript: ENSMUST00000161273
AA Change: V1060E

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: V1060E

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	3.2e-129	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
Blast:DDHD	422	670	2e-65	BLAST
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	945	7.5e-100	SMART
LNS2	1090	1221	3.1e-59	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161479

Predicted Effect

probably damaging
Transcript: ENSMUST00000161938
AA Change: V1064E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: V1064E

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	251	7.5e-116	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
Blast:DDHD	422	670	2e-65	BLAST
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	949	8.37e-104	SMART
LNS2	1094	1225	3.22e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162812
AA Change: V1010E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: V1010E

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	6.1e-132	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	507	515	N/A	INTRINSIC
Blast:DDHD	548	570	6e-7	BLAST
low complexity region	571	589	N/A	INTRINSIC
low complexity region	608	630	N/A	INTRINSIC
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	895	1.66e-98	SMART
LNS2	1040	1171	3.22e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196401

SMART Domains

Protein: ENSMUSP00000142496
Gene: ENSMUSG00000029404

Domain	Start	End	E-Value	Type
low complexity region	29	50	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

97% (34/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	G	T	10: 22,067,256	T275K	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Bpifb9b	C	T	2: 154,311,742	L243F	probably benign	Het
Cd226	A	T	18: 89,246,983		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cep295	A	G	9: 15,334,784	I792T	possibly damaging	Het
Cfap46	T	C	7: 139,661,046	Y469C	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
D630045J12Rik	G	A	6: 38,158,091	P1385S	possibly damaging	Het
Ddb1	A	T	19: 10,606,973	M64L	probably benign	Het
Dyrk1b	G	A	7: 28,185,372	R404Q	possibly damaging	Het
Gal3st2b	A	G	1: 93,939,786	T52A	probably damaging	Het
Galk2	C	A	2: 125,931,273	S208R	probably benign	Het
Gm6169	G	A	13: 97,098,801	T146I	probably damaging	Het
Hap1	A	T	11: 100,354,715	I141N	probably damaging	Het
Hif3a	T	C	7: 17,041,105	S523G	probably damaging	Het
Kirrel	C	T	3: 87,088,485	V381I	probably damaging	Het
Lmbrd1	T	C	1: 24,685,541	S69P	probably damaging	Het
Lrriq1	C	T	10: 103,189,987	V925M	probably damaging	Het
Mmp16	A	G	4: 18,112,001	Y459C	probably damaging	Het
Mtr	A	G	13: 12,188,157		probably benign	Het
Nadk2	T	A	15: 9,085,782	I167N	probably damaging	Het
Neo1	A	G	9: 58,985,634	F242L	probably benign	Het
Shox2	A	G	3: 66,981,489	I23T	possibly damaging	Het
Slc5a12	T	C	2: 110,609,432	V141A	probably damaging	Het
Sstr5	A	G	17: 25,491,901	I118T	probably benign	Het
Taar4	A	G	10: 23,961,014	N174S	probably damaging	Het
Tpcn2	C	A	7: 145,257,218	G581W	probably damaging	Het
Umod	C	T	7: 119,466,193	V538M	probably damaging	Het
Vmn2r44	T	G	7: 8,370,640	S517R	probably damaging	Het
Zc3h12d	G	T	10: 7,867,938	V491L	probably benign	Het
Zfp358	A	T	8: 3,495,454	H12L	possibly damaging	Het
Zkscan7	A	G	9: 122,894,827	D287G	probably benign	Het

Other mutations in Pitpnm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Pitpnm2	APN	5	124121663	unclassified	probably benign
IGL01660:Pitpnm2	APN	5	124123194	missense	probably damaging	1.00
IGL02328:Pitpnm2	APN	5	124121414	missense	probably damaging	0.99
IGL02340:Pitpnm2	APN	5	124130613	missense	probably damaging	1.00
IGL02399:Pitpnm2	APN	5	124140758	splice site	probably benign
IGL02719:Pitpnm2	APN	5	124140602	missense	probably damaging	1.00
IGL03053:Pitpnm2	APN	5	124143601	missense	probably damaging	1.00
IGL03083:Pitpnm2	APN	5	124133382	missense	possibly damaging	0.92
PIT4131001:Pitpnm2	UTSW	5	124131115	missense	probably benign	0.01
R0058:Pitpnm2	UTSW	5	124124030	missense	probably damaging	1.00
R0437:Pitpnm2	UTSW	5	124131089	splice site	probably benign
R0530:Pitpnm2	UTSW	5	124131201	missense	probably damaging	1.00
R0568:Pitpnm2	UTSW	5	124140517	splice site	probably benign
R0926:Pitpnm2	UTSW	5	124131209	missense	probably benign	0.10
R1625:Pitpnm2	UTSW	5	124133433	missense	probably benign	0.05
R2008:Pitpnm2	UTSW	5	124152621	start codon destroyed	probably damaging	0.99
R2120:Pitpnm2	UTSW	5	124127269	missense	probably damaging	1.00
R2448:Pitpnm2	UTSW	5	124123994	missense	probably damaging	1.00
R2509:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2510:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2511:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2520:Pitpnm2	UTSW	5	124129401	missense	probably damaging	0.96
R2860:Pitpnm2	UTSW	5	124121437	missense	probably damaging	1.00
R2861:Pitpnm2	UTSW	5	124121437	missense	probably damaging	1.00
R4407:Pitpnm2	UTSW	5	124152615	missense	possibly damaging	0.57
R4417:Pitpnm2	UTSW	5	124123569	missense	probably damaging	1.00
R4426:Pitpnm2	UTSW	5	124142123	missense	probably benign	0.32
R4458:Pitpnm2	UTSW	5	124121376	missense	probably benign	0.00
R4610:Pitpnm2	UTSW	5	124125371	missense	probably damaging	0.99
R4786:Pitpnm2	UTSW	5	124121743	nonsense	probably null
R4903:Pitpnm2	UTSW	5	124152605	missense	probably damaging	1.00
R5151:Pitpnm2	UTSW	5	124136386	missense	probably damaging	1.00
R5315:Pitpnm2	UTSW	5	124121933	missense	probably benign	0.18
R5592:Pitpnm2	UTSW	5	124142149	missense	probably damaging	1.00
R5792:Pitpnm2	UTSW	5	124130321	nonsense	probably null
R6846:Pitpnm2	UTSW	5	124131171	missense	probably benign	0.00
R6983:Pitpnm2	UTSW	5	124133406	missense	probably damaging	1.00
R7096:Pitpnm2	UTSW	5	124129261	missense	possibly damaging	0.69
R7188:Pitpnm2	UTSW	5	124121303	missense	probably benign	0.31
R7203:Pitpnm2	UTSW	5	124121459	missense	probably damaging	0.96
R7237:Pitpnm2	UTSW	5	124125297	critical splice donor site	probably null
R7257:Pitpnm2	UTSW	5	124125356	missense	possibly damaging	0.88
R7622:Pitpnm2	UTSW	5	124122027	missense	probably benign	0.39
R7677:Pitpnm2	UTSW	5	124123569	missense	probably damaging	1.00
R7736:Pitpnm2	UTSW	5	124123030	missense	possibly damaging	0.47
R7745:Pitpnm2	UTSW	5	124128705	missense	probably benign	0.19
R8041:Pitpnm2	UTSW	5	124121456	missense	probably damaging	1.00
R9070:Pitpnm2	UTSW	5	124121312	missense	probably damaging	1.00
R9218:Pitpnm2	UTSW	5	124127281	missense	probably damaging	0.97
R9423:Pitpnm2	UTSW	5	124133406	missense	probably benign	0.05
R9438:Pitpnm2	UTSW	5	124131279	missense	probably damaging	0.99
R9439:Pitpnm2	UTSW	5	124136126	missense	probably damaging	1.00
R9439:Pitpnm2	UTSW	5	124140596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGGATAACTCGTCAGAACAGGC -3'
(R):5'- AAAGGTGAGGATGTGGCTCC -3'

Sequencing Primer
(F):5'- CTCGTCAGAACAGGCCAGAG -3'
(R):5'- ATGTGGCTCCCTGAGGTGAC -3'

Posted On

2014-10-30